Labshake search
Citations for Thermo Fisher :
1401 - 1450 of 6146 citations for 6 Chloro N methoxy N methyl nicotinamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... NP presenting BG505 V1V2 and a trimeric scaffold (1TD0) presenting ZM109 V1V2 were transiently expressed in N-acetylglucosaminyltransferase I-negative (GnTI-/-) HEK293S cells (Thermo Fisher) (41) ...
-
bioRxiv - Biochemistry 2021Quote: ... the N-terminal His-tagged protein was purified in a single step protocol using HisPur Ni-NTA resin (Thermo Fisher Scientific), equilibrated at RT ...
-
bioRxiv - Immunology 2021Quote: ... were cloned into pCEP4 mammalian expression vector containing N-terminal human Ig kappa leader sequence and C-terminal Avi-tag and His-tag (Invitrogen, USA). Expi293-Freestyle cells cultured at 37°C and 8% CO2 in growth medium containing Expi293 Expression Medium at 3×106/mL in 50 mL media were transfected overnight at 37 °C with 50μg of plasmid in 160μL of ExpiFectamine plus 6mL of OptiMEM-I (all from Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... total RNA from testicular explants (n = 20 males) was extracted by using the commercial RNAqueous®-Micro kit (Ambion, Austin, USA), according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... and a 50 cm analytical column (Acclaim PepMap 100, 75 μm x 50 cm, C18, P/N ES803, Thermo Fisher Scientific). The injection volume was 2 μL out of 18 μL in which the samples were dissolved in the autosampler ...
-
bioRxiv - Cell Biology 2021Quote: ... or si-hsa-CHST15_0003 (n□=□3) or si-hsa-TNFRSF21_0001 (n□=□3) for 24□hours was carried out by using human Clariom™ Sassay (ThermoFisher Scientific) at the Bioinformatics and Expression Analysis (BEA ...
-
bioRxiv - Cell Biology 2021Quote: ... and sterols derivatized in 50 μL N,O-bis(trimethylsilyl) trifluoroacetamide with 1% trimethylchlorosilane (BSTFA + 1% TMCS, Thermo Fisher TS-38831) at 60°C for 1 h ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant 6XHis-tagged TbVps24 (N-terminus tag) was cloned using the pTrcHis TOPO TA expression system (Thermo Fisher Scientific, Carlsbad, CA) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... or mouse monoclonal anti-N-Cadherin clone GC-4 followed by AlexaFluor 647-conjugated goat anti-mouse antibody (1:200 dilution, ThermoFisher Scientific). Staining was performed for 30 min at 4°C ...
-
bioRxiv - Microbiology 2021Quote: Viral N protein was detected using a rabbit anti-SARS-CoV N antibody [32] as a primary antibody with AlexaFluor 568 anti-rabbit IgG or anti-rabbit IgG-HRP (Thermo Fisher) as secondary antibodies together with DAPI to stain the nucleus by indirect immunofluorescence as described previously [33].
-
bioRxiv - Neuroscience 2020Quote: ... The samples were double-blinded microinjected into the cytoplasm of single COS-7 cells (n=100-200 cells per sample) along with fluorescein-labeled dextran (molecular weight 10000, Life Technologies) using a micromanipulator (Narishige) ...
-
bioRxiv - Immunology 2021Quote: ... containing 2’-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG; 50 μM; Thermo Fisher Scientific). To determine FA uptake ...
-
bioRxiv - Microbiology 2021Quote: ... reverse:CCATCCAATCGGTAGTAGCG) or the SARS-CoV-2 N gene (forward: TTACAAACATTGGCCGCAAA, reverse: GCGCGACATTCCGAAGAA) and Power SYBR Green PCR Master Mix (Applied Biosystems) were used to amplify cellular RNA and viral RNA by QuantStudio 6 Flex Real-Time PCR Systems (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2020Quote: Whole-cell lysates were obtained incubating cell pellets with a Lysis Buffer (2% n-dodecyl β-dmaltoside (DDM) (Thermo Scientific, #89903) plus 1X protease inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2022Quote: ... and pcDNA3.1(+)-N-HA-RTEL1-ΔHHD1+2) (Supplementary Table S3) were transfected using Lipofectamine® 2000 reagent (Invitrogen; Cat. No.11668019) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... Synthetic peptides were coupled to rabbit serum albumin (RSA) with the linker Sulfo-m-maleimidobenzoyl-N-hydroxysuccinimide ester (Sulfo-MBS, Thermo Scientific) in a carrier (1):linker (50):peptide (50 ...
-
bioRxiv - Plant Biology 2022Quote: The full-length coding sequence of the genes were cloned into pSPYNE-35SGW (N-terminal YFP) and/or pSPYCE-35SGW (C-terminal YFP) through gateway cloning (Invitrogen™). BiFC was carried out as described (Gou et al. ...
-
bioRxiv - Microbiology 2022Quote: Copies of the SARS-CoV-2 N gene (genomic) were measured by qRT-PCR TaqMan Fast Virus 1-step assay (Applied Biosystems). SARS-CoV-2 specific primers and probes from the 2019-nCoV RUO Assay kit (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... Approximately 2.5 µg of the in vitro synthesized RNA was used to transfect ∼6 ×105 BHK-hACE2-N cells stably expressing the SARS-CoV-2 N and the human ACE2 genes [65] using the MessengerMax lipofection kit (Thermo Scientific) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The samples were dried at 70°C for at least 20 h and the total N (% g dry weight [DW]) and 15N (atom%) contents were analyzed using a Flash2000-DELTAplus Advantage ConFlo? System (ThermoFisher Scientific) at Shoko Science Co. ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Neuroscience 2023Quote: ... SCOs were washed o/n in 1x PBS and cryopreserved gradually in sucrose before being embedded (TissueTek OCT, Fisher Scientific, 10690461) and flash-frozen on dry-ice ...
-
bioRxiv - Neuroscience 2022Quote: ... the muscle layer of the gut was extracted using a forceps n.4 (FST, Germany, EU) and placed in Hank’s buffer solution (HBSS) (Invitrogen, Germany, EU). The tissue was then incubated in Collagenase I (Worthington ...
-
bioRxiv - Neuroscience 2022Quote: ... sympathetic ganglia were extracted using a forceps n.4 (FST, Germany, EU) and placed in Hank’s buffer solution (HBSS) (Invitrogen, Germany, EU). The tissue was then incubated in Collagenase I (Worthington ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were co-transfected with 3.6 μg of pOG44 and 400 ng of either N- or C-terminal pDEST-pcDNA5-c17orf80-BirA*-FLAG using Lipofectamine 2000 (Invitrogen; 11668019) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... and its N-terminal amino-acid sequence was analyzed by Edman microsequencing(39) on a Procise 494 cLC protein sequencer (Applied Biosystems), using the standard pulsed-liquid program for PVDF-blotted proteins.
-
bioRxiv - Neuroscience 2022Quote: HEK293T cells were grown on 10 mm glass coverslips in 24-well plates in DMEM medium (Thermo Fisher, cat n°10566016) supplemented with fetal bovine serum (10% ...
-
bioRxiv - Microbiology 2022Quote: SpRecAA488 was made by covalently modifying primary amines (lysines or N-ter) of the protein with Alexa 488-succinidimyl ester (Molecular Probes, ThermoFisher), in presence of an excess of ssDNA (M13 mp18 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Abcam, USA) (Anti-E-cad/N-cad/Vimentin; 1:200, Cell Signalling, USA) (Rhodamine phalloidin dye, 6.6 µM, ThermoFisher Scientific, USA) at room temperature for 1 hour ...
-
bioRxiv - Cell Biology 2023Quote: ... MEFs were transfected with the isolated N-TAP progranulin plasmid (courtesy of the UF CTRND) using Lipofectamine LTX Reagent with PLUS Reagent (Invitrogen 15338030) according to its included protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... The slides were washed 3 times for 5 min with PBS and mounted with imaging buffer at pH 7.4 (700 mM N-Acetyl-Cysteine (NAC; #160280250, ThermoFisher Scientific, USA) in ddH2O + 20% HEPES solution (#H0887 ...
-
bioRxiv - Cancer Biology 2023Quote: Small RNA (<200 bp) was isolated from fibroids and matched myometrium (n= 5) using mirVana miRNA isolation kit (Thermo Fisher Scientific) according to manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... Immunoreactivity was detected using the ECL Western blot detection reagent LumiGLO (KPL) and exposed to Super RX-N films (Fujifilm) or revealed with iBright™ Imaging System (ThermoFisher). Protein expression was normalized to α-actinin or Gadph ...
-
bioRxiv - Developmental Biology 2023Quote: ... and connective tissue were scraped away from the biopsy before digesting O/N at 4°C in HBSS without Ca2+ and Mg2+ (Thermo Fisher) containing dispase at a final concentration of 500 caseinolytic units/mL (Corning ...
-
bioRxiv - Molecular Biology 2023Quote: ... N-terminally truncated PPR56 coding sequences were amplified with classic PCR approach using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific) as described [23] to retain 14 native amino acids upstream of the most N-terminal completely retained PPR (Fig ...
-
bioRxiv - Plant Biology 2023Quote: ... and AtILR1 open reading frame sequences deleted of the 25-N-terminal signal peptide-encoding codons were amplified using Phusion Taq Polymerase (Thermo Fisher) prior to cloning into pETM11 plasmid in the BL21 (DE3 ...
-
bioRxiv - Neuroscience 2023Quote: ... centrifuged at 300g for 5 minutes at 4°C and homogenized in cold N-PER Neuronal Protein Extraction Reagent (Thermo Fisher) or cold RIPA lysis buffer (Thermo Fisher ...
-
bioRxiv - Biochemistry 2023Quote: INIP and the TRR complex were labeled on N-termini using AF488 dye (Alexa Fluor 488 carboxylic acid succinimidyl ester, Thermo Fisher). Before labeling ...
-
bioRxiv - Cell Biology 2023Quote: ... All the IHO1 truncations were expressed with the 3C HRV cleavable N-terminal MBP tag in suspension culture of High Five™ Cells (Invitrogen) in Sf-900™ III SFM medium ...
-
bioRxiv - Bioengineering 2023Quote: ... The levels of RNA corresponding to the N protein-encoding gene of SARS-CoV-2 were measured using the TaqMan Fast Virus 1-step Master Mix (Thermo Scientific). Each 20-μL reaction mixture contained 5.0 μL of 4× TaqMan Fast Virus 1-Step Master Mix ...
-
bioRxiv - Developmental Biology 2023Quote: Stem cells were grown on culture plates coated with 5micro μg ml-1 recombinant human Vitronectin (rhVTN-N, Life Technologies, #A14700). HESCs were grown in mTeSR1 (StemCell Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... prior to a one-hour incubation with SARS-CoV-2 N protein antibody (clone 1C7C7) at a 1:300 dilution and a AF594-conjugated Goat-anti-mouse secondary (ThermoFisher, A11005). Slides were counterstained with DAPI and scanned on an Akoya Polaris Vectra imaging system ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Cell Biology 2023Quote: ... The PSA-NCAM+ cells were re-plated at a density of 50 × 103 cells per cm2 to the plate coated with vitronectin (VTN-N, 5 μg/mL; ThermoFisher Scientific) and laminin (rhLaminin-521 ...
-
bioRxiv - Biochemistry 2023Quote: ... Dried cell lysate was digested using a solution of 5 nanogram/microliter LCMS grade trypsin (Pierce) in 0.1% n-Dodecyl-beta-Maltoside Detergent (DDM, Thermo Fisher, 89902) and 50mM TEAB ...
-
bioRxiv - Neuroscience 2023Quote: The forebrain sections were incubated with Blue NeuroTrace Fluorescent Nissl Stains (1:100 dilution by PBS, N-21479, Thermo Fisher Scientific) at room temperature for 2-3 hours ...
-
bioRxiv - Plant Biology 2023Quote: ... OLV-FL or one of the truncated OLV versions were shuttled simultaneously with PYE into the destination vector pBiFC-2in1-NN (Grefen and Blatt, 2012) (N-terminal nYFP and cYFP fusions) via multisite LR reaction (Gateway, Thermo Fisher). Hereby pBiFC-2in1-NN:OLV-FL-PYE and pBiFC-2in1-NN:PYE-OLV-FL (additionally all truncated OLV versions were cloned into pBiFC-2in1-NN combined with PYE as described for OLV-FL ...
-
bioRxiv - Plant Biology 2023Quote: ... For N-terminal fusions the pDONR entry clones with PYE and OLV sequences were used for Gateway LR reaction (Gateway, Thermofisher, Scientific) to generate the destination vectors based on pH7WGY2 (N-terminal YFP ...