Labshake search
Citations for Thermo Fisher :
9151 - 9200 of 10000+ citations for 7 METHOXY 4 4 DIMETHYL 3 4 DIHYDRO 2H NAPHTHALEN 1 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... were quantified using an avidin and 4’-hydroxyazobenzene-2-carbocylic acid assay according to the manufacturer’s instructions (Fisher Scientific). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: ... iProtein extracts were resolved in NuPageTM 4-12 % BisTris Protein Gels (Cat No. NP0321BOX, Thermo Fisher Scientific, MA, US), and blotted onto an Invitrolon™ PVDF (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: HCT116 cell lysates were combined with Laemmli buffer and resolved on Novex WedgeWell 4-20% Tris-Glycine gels (Invitrogen). Gels were either stained with Novex SimplyBlue SafeStain (Invitrogen ...
-
bioRxiv - Physiology 2021Quote: ... Approximately 30 μg of soluble supernatant was run on a 4-20% Tris-Gly SDS PAGE gel (Life Technologies) and transferred onto a nitrocellulose membrane using an iBlot2 device (Life Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... The resuspended pellets were analyzed using Novex 4-20% SDS– SDS-PAGE mini gel (Thermo Fisher Scientific, Waltham, MA) to quantify the S trimer/rRBD copies ...
-
bioRxiv - Microbiology 2021Quote: ... samples were not heated nor reduced before being run in a 4-12% acrylamide denaturing gel (NP0323, NuPAGE, ThermoFisher), and then transferred onto a nitrocellulose membrane (IB23001 ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were washed again in PBS and incubated overnight with 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) and Alexa Fluor 647-conjugated βIII tubulin (Abcam ab190575) ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclear staining was performed by incubating slides with 4’,6-diamidino-2-phenylindole (DAPI, final 0.5 μg/mL; Invitrogen). Images were captured using an epifluorescence microscope (Nikon Eclipse Ni ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid transfections were performed according to manufacturer’s protocol in 12 -well plates or 4-well Lab Tek II chamber slides (Nunc) using jetPRIME reagent (VWR INTERNATIONAL ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were incubated with primary antibody diluted in blocking buffer ± 0.3% Triton-X100 overnight at 4°C followed by application of relevant fluorescent secondary-conjugated antibody (Alexa Fluor, Invitrogen). An identical preparation without the primary antibody was used as a negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... PC-3 cells were mock-transfected or transfected with 0.5 to 4 μg LDHA-WT or LDHA-mutant using Lipofectamine 3000 (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... RNP complexes (Cas9 protein + Synthego FLCN_exon 4 GAGAGCCACGAUGGCAUUCA + modified EZ scaffold) were transfected transiently in RPTEC cells using Neon Electroporation System (ThermoFisher), where after knock-out status of single-cell derived clones was validated by western blot and Sanger sequencing.
-
bioRxiv - Microbiology 2022Quote: ... soluble fractions were then separated under native conditions on a 4–16% NativePage Novex BisTris Protein Gel (Life Technologies) and transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μl of proteins obtained after TCA precipitation were separated by 4-12% polyacrylamide gradient gel electrophoresis (NuPAGE-Invitrogen) in 1X MES buffer (50 mM MES ...
-
bioRxiv - Cell Biology 2020Quote: ... Ni-NTA His.Bind® Resin (2-4 ml) was packed into a 10 ml Pierce disposable column (Thermo Fisher) and connected to the peristaltic pump ...
-
bioRxiv - Microbiology 2022Quote: ... at 90°C for 10 min before being run on a 4-12% acrylamide denaturing gel (ThermoFisher, #NP0323 NuPAGE). Proteins were then transferred onto a nitrocellulose membrane (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... in carbonate buffer (carbonate buffer 15 mM pH 9.6) was coated overnight at 4°C in 96 well ELISA plates (Nunc). Wells were then blocked with 5% dry milk for 2h at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... samples were quickly washed 3x with PBS before fixation with 100 µL of 4 % paraformaldehyde (PFA, Fisher scientific, #50980494) for 12 min at RT ...
-
bioRxiv - Genetics 2022Quote: ... centrifuged for 5 minutes at 500xg at 4°C and resuspended in 70µl flow cytometry buffer (PBS, 10% ESC-grade FBS (Gibco), 0.5mM EDTA ...
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: ... Ten microliters were used for SDS-Page analysis on Bolt™ 4-12% Bis-Tris Plus Gels (Thermo Scientific). Electrophoresis separation was performed in NuPAGE™ MOPS SDS Running Buffer (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell extracts (20 μg per lane) were separated by NuPAGE™ 4-12% Bis-Tris protein gels (ThermoFisher Scientific) and transferred to nitrocellulose membranes ...
-
bioRxiv - Molecular Biology 2019Quote: ... RT-PCR was then carried out in ligation buffer by adding 8.5 ul of the following mix to the sample: 4 ul 5X first-strand buffer (Invitrogen), 1.5 ul 100mM DTT ...
-
bioRxiv - Biochemistry 2019Quote: ... 20 μg total protein for each sample was run on 4-12% Bis-Tris gels (Thermo Fisher Scientific NP0322) with MES buffer (Thermo Fisher Scientific NP002) ...
-
bioRxiv - Neuroscience 2019Quote: ... The supernatant containing the 4°C oligomers were assayed for protein content using the BCA kit (Thermo Fisher Scientific). For control experiments ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentration was determined using Bradford reagent and samples were run on a 4-12% Tris/Bis gel (Invitrogen). Protein was then transferred to an Immobilon-P PVDF membrane (Millipore) ...
-
bioRxiv - Molecular Biology 2019Quote: ... SDS-PAGE was performed on NuPAGE 4–12% Bis–Tris gels with NuPAGE MOPS SDS Running Buffer (Life Technologies). Following transfer of proteins to nitrocellulose membranes ...
-
bioRxiv - Molecular Biology 2019Quote: ... HEK293T cells (4 × 106) in 100 mm dishes were transfected with 10 µg pDEST12.2-NSUN2-FLAG using Lipofectamine 2000 (Invitrogen), and cultured for 48–72 h at 37°C in 5% CO2 ...
-
bioRxiv - Microbiology 2019Quote: ... Cell nuclei were stained with ProLong™ Diamond Antifade Mountant with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific). Samples were imaged using a confocal setup (Zeiss Airyscan equipped with a 63x ...
-
bioRxiv - Cancer Biology 2020Quote: ... denaturated 5 min at 95°C and finally loaded on NuPAGE 4-12% Bis-Tris protein gels (Life Technologies) and electro-transferred onto nitrocellulose membranes ...
-
bioRxiv - Immunology 2019Quote: ... PBMCs were then incubated at 4°C with LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (Thermo Fisher Scientific) for 30 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Equal amounts of protein (30-50 µg) were fractionated on 4-12% gradient SDS-polyacrylamide gel electrophoresis gel (Invitrogen) and transferred to PVDF membrane (Roche) ...
-
bioRxiv - Biochemistry 2019Quote: ... Elution fractions were analyzed by reducing SDS-PAGE using precast NuPAGE 4-12% Bis-Tris gels (Thermo Fisher Scientific) with 1x MOPS buffer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... and incubated for 5min at 90°C before loading on pre-cast 4-12% Bis-Tris acrylamide gel (Invitrogen). Subsequently ...
-
bioRxiv - Immunology 2019Quote: ... Nuclear lysates (10µg per lane) were resolved on precast NuPAGE 4-12% Bis-Tris protein gels (Invitrogen, Carlsbad, CA) and proteins transferred to PVDF membranes (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... 4°C and supernatants were filtered through a 0.2 μm pore size Nalgene Disposable Filter Unit (Thermo Fisher Scientific) to remove the remaining cells ...
-
bioRxiv - Biochemistry 2020Quote: pcDNA4-V5-NAA80-M23L was constructed by subcloning NAA80 from pcDNA3.1-NAA80-V525 into the TOPO TA vector pcDNA 4/Xpress-His (Invitrogen). Then the M23L mutation was introduced and the N-terminal Xpress tag was replaced with a V5 tag ...
-
bioRxiv - Cancer Biology 2020Quote: ... The beads with antigens captured were loaded onto a SDS-PAGE gel (4-20% gradient polyacrylamide) (Thermo Fisher Scientific) in duplicates ...
-
bioRxiv - Cell Biology 2019Quote: ... Cell extracts were centrifuged at 10,000g for 15 min at 4°C and incubated with magnetic beads (Dynabeads, Invitrogen) conjugated with specific antibodies at 4°C for 2 hours ...
-
bioRxiv - Cell Biology 2019Quote: Cells were seeded 18 h before transfection on sterile 4 chamber dishes at 60% confluency.Transfection was carried out using Lipofectamine2000 (Invitrogen) and DNA plasmid at the ratio of 3:1 in HeLa and 2:1 for 293T cells and U2OS cells with total DNA of 1500 ng for imaging and 2000 ng for western blot ...
-
bioRxiv - Systems Biology 2020Quote: LC-MS/MS acquisition in samples of 30µg of 3,910 proteins was prepared from the groups of patient biopsies running on a NUPAGE 4-12% acrylamide gel (Invitrogen) and stained in Coomassie blue (Simply-blue Safestain ...
-
bioRxiv - Immunology 2020Quote: Lysate of Bacillus anthracis was loaded on a 4-12 % gradient NuPAGE Novex SDS-PAGE gel (Invitrogen, Thermo Fisher). After migration ...
-
bioRxiv - Immunology 2020Quote: Lysate of Bacillus anthracis was loaded on a 4-12 % gradient NuPAGE Novex SDS-PAGE gel (Invitrogen, Thermo Fisher). After migration ...
-
bioRxiv - Molecular Biology 2020Quote: ... the annealing reaction mixture was analysed using a 4% agarose gel containing a DNA stain (Thermo Fisher Scientific, #S33102). The bands were visualized using a UV transilluminator (Bio-Rad laboratories ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were fixed for 15 minutes in fresh 4% PFA made from 16% PFA (methanol free ampules, Thermo Scientific) diluted in PBS ...
-
bioRxiv - Microbiology 2019Quote: ... Coverslips were mounted on glass slides in 4′,6-diamidino-2-phenylindole (DAPI) containing Fluoromount-G medium (Thermo Fisher). Images were acquired by an Eclipse A1 laser-scanning microscope ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Homogenised leaf tissues were centrifuged at 18,000 g 10 min 4 °C and 2 μL supernatant mixed with 48 μL Bradford reagent (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... SDS–PAGE and immunoblotting were performed using the 4-12% NuPage gel system (Life Technologies, Foster City, CA, USA). Membranes were blocked in 5% milk/TBS-Tween ...
-
bioRxiv - Molecular Biology 2021Quote: ... SDS-PAGE gels were loaded with 5 - 15 μL of lysate per lane (NuPAGE 4-12% Bis-Tris; Invitrogen). Lysates were diluted with additional 1x NuPAGE LDS buffer if necessary ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting DNA and RNA were analyzed for quantity using an Invitrogen™ Qubit™ 4 Fluorometer (Invitrogen, USA). DNA and RNA sample concentrations above 10 ng ul-1 were normalized to 10 ng ul-1 prior to sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... The samples were run on Novex 4-12 % gradient gel (Bis-Tris) in 1x NuPAGE™ MES buffer (Invitrogen) at 150 V for 60 min on ice followed by 30 min at 200 V ...