Labshake search
Citations for Thermo Fisher :
9401 - 9450 of 10000+ citations for 7 METHOXY 4 4 DIMETHYL 3 4 DIHYDRO 2H NAPHTHALEN 1 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... then cooled down to 42 °C and digested with 4 U of agarase enzyme/400 μl sample (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... 15µg of each lysate prepared from muscle was loaded on NuPAGE 4-12% Bis-Tris acrylamide gels (Life Technologies) and run at 80V for 8 min to stack proteins in a single band ...
-
bioRxiv - Neuroscience 2023Quote: ... The samples were centrifuged at 13,300 rpm for 10 minutes and ran on NuPage 4-12% Bis-Tris polyacrylamide gels (Invitrogen). Proteins were transferred onto a Immobilon PVDF membrane (Millipore) ...
-
bioRxiv - Microbiology 2023Quote: ... Fetuses and placenta were flash frozen in dry ice or fixed in 4% paraformaldehyde (Thermo Fisher Scientific #J19943.K2) for 72 hours at 4°C for immunohistochemistry ...
-
bioRxiv - Bioengineering 2024Quote: ... as previously described.85 Nunc MaxiSorp plates were coated with 4 µg/mL streptavidin (Thermo Fisher Scientific, cat.: PI21122) in PBS at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... a Qubit high-sensitivity DNA assay kit and a Qubit Fluorometer (Qubit 4, both Thermo Fisher Scientific, MA, USA) was used ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA from 4 independent replicates for each strain/couple were quantified using the Qubit RNA HS Assay (Invitrogen) and confirmed on RNA6000 RNA chips on Bioanalyzer (Agilent ...
-
bioRxiv - Genetics 2023Quote: ... or PstI+EcoRI (for the ectopic S2-1000bp donor construct) 4 hours at 37° C and migrated overnight in 0.8% Agarose-LE (Affymetrix) in 1X TBE at 50 V ...
-
bioRxiv - Cell Biology 2023Quote: ... The samples were centrifuged at 13,300 rpm for 10 minutes and ran on NuPage 4-12% Bis-Tris polyacrylamide gels (Invitrogen). Proteins were transferred onto a Immobilon PVDF membrane (Millipore) ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR product of the primers listed above was ligated into the pCR™4-TOPO® vector (Invitrogen), and transformed into One Shot® TOP10 E ...
-
bioRxiv - Molecular Biology 2023Quote: ... and MUTYH KO cells were obtained by infection of BJ FAP-TRF1 WT with lentivirus expressing respectively guide RNAs targeting OGG1 exon 4 (gRNA3, sequence GCTACGAGAGTCCTCATATG) and MUTYH exon 2 (gRNA5, sequence GCATGCTAAGAACAACAGTC) and selected with 1.5 µg/ml Puromycin (Gibco). OGG1 KO/MUTYH KO (DKO ...
-
bioRxiv - Plant Biology 2022Quote: ... whilst the quantification was performed using Qubit 4 Fluorometer and the dsDNA HS Assay Kit (Thermo Fisher Scientific, USA). The 72 libraries were created in accordance with the manufacturer’s instructions and loaded on a MinION R9.4.1 flow cell (FLO-MIN106 ...
-
bioRxiv - Biophysics 2023Quote: ... The gels were run at 4°C using the electrophoresis system according to the Invitrogen instructions (ThermoFisher Scientific, USA), and then stained with the Pierce Silver Staining kit according to the manufacturer’s instructions (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... and concentration was quantified with a QuBit 4 Fluorometer (Qubit dsDNA HS Assay Kit, Life Technologies, Thermo Fisher Scientific) or by qPCR (ProNex NGS Library Quant Kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... and concentration was quantified with a QuBit 4 Fluorometer (Qubit dsDNA HS Assay Kit, Life Technologies, Thermo Fisher Scientific) or by qPCR (ProNex NGS Library Quant Kit ...
-
bioRxiv - Microbiology 2022Quote: ... cells were washed twice with sterile PBS and fixed with 40μl of freshly prepared 4% paraformaldehyde (PFA, ThermoFisher Scientific) for 10 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: The eluted proteins solubilized in Laemmli buffer were stacked in the top of a 4-12% NuPAGE gel (Invitrogen). After staining with R-250 Coomassie Blue (Biorad) ...
-
bioRxiv - Microbiology 2022Quote: ... heated for 10 min at 95°C and separated on 4–12% Bis-Tris NuPAGE gels (Thermo Fisher Scientific) in the presence of antioxidant (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... tissue sections were treated as described above and incubated overnight at 4 °C with antibodies specific for mCherry (Invitrogen), Gas6 (R&D Systems) ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibody incubation was performed overnight at 4°C in PBST with 5% normal goat serum (Thermo Fisher, USA). Secondary antibodies were diluted in PBST and incubated for 1 hr at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... The obtained cDNA was diluted to 2-4 ng/µl for subsequent qPCR with the Sybr Green (Applied Biosystems) method ...
-
bioRxiv - Neuroscience 2023Quote: ... or HEK293T cells (0.5 mg) were precleared for 30 minutes at 4°C using Protein A/G Sepharose beads (ThermoFisher). Precleared lysates (equal amounts of protein ...
-
bioRxiv - Neuroscience 2023Quote: ... Equal amounts of protein were then loaded onto a NativePAGE Novex 4-16% Bis-Tris Protein Gel (Life Technologies). A wet blotting method was used to transfer the proteins onto a PVDF membrane (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... and brain tissues were collected from each mouse and fixed in 4% paraformaldehyde (Thermo Scientific, J19943-K2, Lot: 214182) for 3 days at +4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were washed quickly 5x in cold PBS before being fixed with pre-warmed (37°C) 4% PFA (ThermoFisher) for 20 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... while their concentrations were quantified using Qubit 4 Fluorometer using Qubit dsDNA HS Assay Kit (ThermoFisher Scientific, MA, USA). Gene expression libraries were sequenced by NextSeq 550 using High Output Kit v2.5 (150 Cycles ...
-
bioRxiv - Immunology 2023Quote: CHO cells that were stably transfected with human CTLA-4 have been reported.23 CHO cells were grown in DMEM (Dulbecco’s Modified Eagle Medium, Gibco) supplemented with 10% FBS (Hyclone) ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were heated at 95℃ for 10min and separated on 4–20% acrylamide Tris-glycine gradient gels (Life Technologies). Proteins were transferred to PVDF membranes (EMD Millipore ...
-
bioRxiv - Biochemistry 2023Quote: ... The established stable cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Nacalai Tesque) supplemented with 4∼5% fetal calf serum (FCS; Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Each sample was mixed with DNA loading dye (Thermo) and electrophoresed in 4-20% or 20% TBE PAGE (Invitrogen). Each gel was exposed to an imaging plate (Fuji film ...
-
bioRxiv - Cell Biology 2023Quote: ... respectively at 4 °C overnight and secondary antibody conjugated to Alexa Fluor 594 or Alexa Fluor 488 (Life Technologies) at room temperature for 1 h ...
-
bioRxiv - Genetics 2023Quote: ... When 80% confluent (approximately every 4 days) hiPSCs were dissociated using 0.5 mM EDTA (Invitrogen; cat. no. 15575-038) in DPBS (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... Quantity and quality of DNA for each sample was assessed using a Qubit 4 fluorometer (Invitrogen, Waltham, MA, USA) and a TapeStation 4150 (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... washed in PBS/0.1% triton x-100 (20 min), incubated (4°C, overnight) with a streptavidin-HRP probe (Invitrogen), washed in PBS/0.1% triton x-100 (20 min) ...
-
bioRxiv - Microbiology 2023Quote: Basal media samples collected during the infection process were separated on BoltTM 4-12% Bis-Tris gradient gels (ThermoFisher) using 20 μg protein/lane and BoltTM Loading Dye (ThermoFisher) ...
-
Functional characterization of ATP13A2 variants associated with distinct neurodegenerative disordersbioRxiv - Molecular Biology 2023Quote: ... 10 μg of protein was loaded on a NuPage 4-12% Bis-Tris gel (Thermo Fisher Scientific, Bio-Rad) and separated during an electrophoresis run at 150 V in MES running buffer (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... Each well was fed with 4 mL of Forebrain Third Media (DMEM/F12 Thermo Fisher 11320033, N2 Life Technologies 17502048 ...
-
bioRxiv - Immunology 2023Quote: ... Cells were pelleted by centrifugation at 500xg for 10 minutes at 4°C and re-suspended in 1ml of 0.2µM SYTOX Green (Invitrogen; S7020) reagent diluted 1:1000 in PBS from a 5mM stock ...
-
bioRxiv - Immunology 2023Quote: ... The lysate was incubated overnight at 4 °C with 50-100 μl DynaBeads IgG magnetic beads (Thermo Fisher Scientific) that had been pre-incubated with 2.5-5 μg appropriate antibodies ...
-
bioRxiv - Immunology 2023Quote: ... and cellular debris spun down at 12,000 g for 5 minutes before being subjected to electrophoresis on Bolt 4- 12% Bis-Tris gels from Invitrogen/Thermo Fisher (Cat ...
-
bioRxiv - Immunology 2023Quote: ... and cells were washed once with PBS and fixed with 4% paraformaldehyde (EM Grade, Fisher Scientific, #50-980-495) in PBS for 20 minutes ...
-
bioRxiv - Immunology 2023Quote: ... Intracellular staining was performed for 45 minutes at 4°C after fixation with the FOXP3 Fix/perm kit (Invitrogen). In some studies ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was slowly thawed at 4°C and treated with 10 U of Turbo DNase (Thermo Fisher Scientific) on ice for 10 min to remove the genome DNA ...
-
bioRxiv - Microbiology 2023Quote: ... separating proteins by electrophoresis with Chameleon Pre-Stained Protein Ladder (Li-Cor) on 4–12% Bis-Tris Gels (Invitrogen) at 150 V for 90 min ...
-
bioRxiv - Microbiology 2023Quote: ... and loaded 10 µl (100 ng) of the sample on NuPAGE 4–12% Bis-Tris Protein Gel (Thermo Fisher), separating proteins by electrophoresis with Chameleon Pre-Stained Protein Ladder (Li-Cor ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary tenocytes were diluted to 10,000 cells/mL and 500uL was seeded in each well of a 4-chamber well slide (Nunc Lab-Tek II Chamber Slide System ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were then washed 4 times with PBS-T and incubated with fluorescence conjugated secondary Alexa antibodies (Life Technologies) in PBS-T with 1% NDS at room temperature for 1 hr ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by SDS PAGE in Novex™ 4-¬20% Tris-¬Glycine ZOOM™ Protein Gels (Thermo Fisher Scientific, USA) with XCell SureLock™ Mini-Cell Electrophoresis System (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... transgenic hg13 larvae (mmachchg13/hg13 Tg(col2a1a:EGFP)) were staged and fixed at 5 DPF with 4% paraformaldehyde (Fisher Scientific). Larvae were dissected for genotyping and unbiased imaging was performed on the remaining head tissue ...
-
bioRxiv - Bioengineering 2022Quote: ... USA) before they were grown to a suitable density (24□hours) and fixed with 4% formaldehyde (R37814, Invitrogen, USA) for 15□min ...