Labshake search
Citations for Thermo Fisher :
6901 - 6950 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... HepG2 cells were cultured at 37°C in 5% CO2 in DMEM (GIBCOTM, Invitrogen Corp., Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Biophysics 2021Quote: ... trypsinized for 3 mins with 5 ml of an EDTA/Trypsin solution (0.05 %, 59417C, Gibco, Thermo Fisher), and diluted with low glucose DMEM (Dulbecco’s modified Eagle’s medium ...
-
bioRxiv - Microbiology 2021Quote: ... purified His-RBD was diluted to 200 μg/mL in PBS buffer containing Sypro Orange 5× (ThermoFisher) in a 96-well white PCR plate ...
-
bioRxiv - Microbiology 2021Quote: ... The 20 µl reaction volume consisted of 5 µl Taqman Fast Advanced Mastermix 4x (Thermo Fisher Scientific), 0.4 μl of tat 2.0 forward primer and rev reverse primer (each at 20 µM ...
-
bioRxiv - Developmental Biology 2021Quote: Cells were maintained pluripotent and cultured at 37°C in 5% CO2 in 25 cm2 flasks (Nunc) coated with 0.1% gelatin (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: NIH/3T3 cells were cultured at 37 °C and 5% CO2 in DMEM high glucose (Gibco, 41965039) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Immunology 2020Quote: ... centrifuged at 14,000 RPM for 5 min at 4°C and resuspended in UltraPure H2O (Ambion, UK). Purified transcripts were capped using the ScriptCap™ Cap 1 Capping System Kit (CellScript ...
-
bioRxiv - Cell Biology 2021Quote: Edited U937 cells were washed in PBS with 5% heat-inactivated fetal bovine serum (Gibco 10082-147), resuspended at 106 cells/mL and then treated with Human TruStain FcX blocker (BioLegend 422302) ...
-
bioRxiv - Neuroscience 2021Quote: ... diluted 5% volume to volume in paraffin oil (Fluka Analytical, 76235) and acetic acid (Fisher Scientific, A385) diluted in 5% volume to volume in water — using a stimulus controller (Ockenfels Syntech ...
-
bioRxiv - Plant Biology 2021Quote: ... 5-DAG seedlings were incubated in the dark in 10 μg/mL PI (Invitrogen, cat. n. P4170) for 10 min and then rinsed twice with water and observed under a Zeiss LSM 700 confocal microscope (Zeiss ...
-
bioRxiv - Microbiology 2020Quote: ... flanked by 5’ Nhel/3’Apal sites for subcloning into the pcDNA3.1(+) vector (Thermo Fisher Scientific, USA). HEK293T cells and Vero E6 cells were purchased from ATCC ...
-
bioRxiv - Immunology 2019Quote: ... Supernatants were discarded and cells resuspended in 100μl PBS with 5% foetal bovine serum (FBS; Gibco, UK) and 0·1% sodium azide (Sigma) ...
-
bioRxiv - Biophysics 2021Quote: ... cell nuclei were stained by exposure for 5 min to 1 mg/100 ml Hoechst 33342 (ThermoFisher) in water.
-
bioRxiv - Bioengineering 2021Quote: ... The paraffin block was cut into 5-µm sections and placed on Superfrost Plus slides (Thermo Fisher). Sections were dried overnight and then subjected to immunohistochemistry (IHC ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR analysis was performed in a QuantStudio 5 Real-Time PCR System (Applied Biosystems). Primers and TaqMan probes were as follows ...
-
bioRxiv - Biochemistry 2021Quote: ... 2′-(or-3′)-O-(N-Methylanthraniloyl) adenosine 5′-triphosphate (mant-ATP, Thermo-Fisher Scientific, Waltham, MA, USA) was serially diluted to concentrations of 5 -15 μM in assay buffer and added to the myosin at a final concentration of 1X -1.2X the final concentration of myosin ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 μg/mL human recombinant laminin 521 (BioLamina #LN521-02) in E8 basal medium (Gibco #A1517001) supplemented with 1% Penicillin/Streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... 5∼15 ng DNA per reaction in 384-well Q-PCR plates (Applied Biosystems™ Cat. # 4483285) with total 12 μL reaction ...
-
bioRxiv - Biochemistry 2020Quote: ... The samples were loaded onto a trapping column (Thermo Scientific, PepMap100, C18, 300 μm X 5 mm), using partial loop injection ...
-
bioRxiv - Biophysics 2020Quote: ... MEFs co-expressing FHL2-eGFP and Lifeact-mApple were incubated with 5 μg/mL Hoechst (Invitrogen, H1399) for 1 hour ...
-
bioRxiv - Immunology 2021Quote: ... Lung and brain sections were washed twice for 5 min and stained with DAPI (Life technologies, #D1360) for 5 min at RT ...
-
bioRxiv - Genetics 2021Quote: ... individual myofibres were isolated by enzymatic digestions and then loaded with 5 µM fluo-4AM (Molecular Probes) for 45 min at room temperature in a normal rodent Ringer’s solution consisting of (in mM) ...
-
bioRxiv - Cancer Biology 2020Quote: ... For lipid peroxidation cells were stained with either 5 μM BODIPY™ 581/591 C11 (ThermoFisher Scientific) or MitoPerOx (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... and 5% CO2 in DMEM (for HEK293 and HeLa) supplemented with 10% Fetal bovine serum (Invitrogen, Switzerland) and 1% of Penicillin/Streptomycin (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 μl of RNase A/T1 mix (2 μg/μl, 5 U/μl, Thermo Scientific, cat#EN0551) was added to 400 μl of the cleared lysate and incubated for 20 min at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... NECs were harvested using EDTA-PBS for 5 min and resuspended in Neurobasal medium (Thermo Fisher Scientific) consisting of 1% N2 (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... and 50 μL of the 3,3′-dipropylthiadicarbocyanine iodide (DiSC3(5)) dye (Thermo Fisher Scientific, Waltham, MA, USA), prepared separately in 0.05×PDB at a concentration of 6 µM ...
-
bioRxiv - Microbiology 2022Quote: ... Bacteria were stained with 5 µM SYTO9 (live; green) and 10 µM propidium iodide (dead; red) (ThermoFisher) and incubated for 15 min at room temperature in the dark ...
-
bioRxiv - Systems Biology 2022Quote: ... ‘mitoSOX red’ to stain intracellular superoxide (at 5 µM final concentration, Thermo Fisher scientific Cat. No. M36008) or ‘cellROX orange’ to stain intracellular ROS (at 5 µM final concentration ...
-
bioRxiv - Immunology 2022Quote: ... blocked for 2 hours at room temperature with 1X PBS supplemented with 5% Fetal Calf Serum (Invitrogen) and 0.25% Tween-20 (Invitrogen) ...
-
bioRxiv - Genomics 2022Quote: ... for 3–5 s and then washed thoroughly in phosphate-buffered saline (PBS) (pH 7.4, Gibco, USA). Single zona pellucida-free embryos were carefully pipetted and placed into individual tubes containing 2 μL PBS ...
-
bioRxiv - Immunology 2022Quote: ... 5 pmol of siRNA or scrambled negative control was mixed with lipofectamine RNAiMAX Reagent (Thermo fisher Scientific) to create a 1 pmol siRNA solution ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 were labeled with 10 μM Cell Proliferation Dye eFluor® 670 (Invitrogen) and then stimulated with virus ...
-
bioRxiv - Cancer Biology 2022Quote: ... Medium was supplemented with 5% (Ishikawa cells) or 10% (rest of cells) foetal bovine serum (FBS, Gibco) and 1% Penicillin/Streptomycin (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.5 mM probenecid (Life-Technologies: catalog # P36400) and 5 µM Fluo-3 (Life Technologies; catalog # F-14218). Cells were incubated at 37°C for 30 minutes before being centrifuged and resuspended in modified L-15 media containing 2% FBS and 2.5 mM probenecid ...
-
bioRxiv - Cell Biology 2022Quote: ... or 5 nM Silencer select siRNAs were transfected using Lipofectamine RNAi max transfection reagent (Thermo Fisher Scientific) at the same time as cell seeding ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-mM primer mix and 5-μl SYBR green Select master mix CFX (Thermo Fisher, Cat. #4472942). Every reaction was done in triplicate and for every sample ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples was incubated with DAPI for 5 minutes and mounted (ProLong™ Diamond Antifade Mountant, Life Technologies).
-
bioRxiv - Biochemistry 2022Quote: ... or EGFP-FMRP and mCherry-DHX9-HD were grown at 37 °C (5% CO2) in DMEM (Gibco) supplemented with 10% FBS (Benchmark) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The thermal cycling and data collection were performed on Quantstudio 5 Real-Time PCR instrument (Thermo Fisher), using the thermal cycling protocol 2 min at 50 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... The protein-antibody-sepharose mixture was then washed 5 times in Pierce IP lysis buffer (ThermoFisher Scientific) and resuspended in 2X Laemmli sample buffer (Sigma) ...
-
bioRxiv - Cell Biology 2022Quote: ... the 5 kb PCR fragment was coupled to magnetic streptavidin beads (Dyna-beads M-270 Streptavidin, ThermoFisher) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Fixed HUVEC were blocked for 1h at RT in blocking solution (5% FBS, 2X antibiotic-antimycotic (Gibco), 0.1% sodium azide (s2002-100G ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5 μl serum samples collected at E19 were loaded into Bis-Tris gels (NuPAGE Novex, Life technologies) and transferred to nitrocellulose membranes (Invitrogen) ...
-
bioRxiv - Genomics 2019Quote: ... 1 µg of each of the samples was combined with 5 µg Cot-1 DNA (15279011, ThermoFisher) and 1 µl of 1mM blocking oligo (5’ AGGTTAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAA 3’ ...
-
bioRxiv - Bioengineering 2019Quote: ... Cells were cultured at 37 °C with 5% CO2 in RPMI 1640 with L-glutamine (Life Technologies), supplemented with 10% fetal bovine serum (Omega) ...
-
bioRxiv - Genomics 2019Quote: ... and the 5’ overhang was repaired using a biotinylated residue (0.4 mM biotin-14-Datp (INVITROGEN, America). The resulting blunt-end fragments were ligated in situ (10X NEB T4 DNA ligase buffer (NEB ...
-
bioRxiv - Cell Biology 2019Quote: ... PKC-specific custom siRNA targeting to endogenous human PKCα (5’-CAGAAGAACTGTATGCAAT-3’) was purchased from Ambien (ThermoFisher). To perform knockdowns ...
-
bioRxiv - Molecular Biology 2019Quote: ... in 5% fetal bovine serum (Atlanta biologics, cat # S11550) and 1% penicillin/streptomycin (Life technologies, cat# 15070) at 37°C ...