Labshake search
Citations for Thermo Fisher :
6701 - 6750 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
β-1,6-glucan plays a central role in the structure and remodeling of the bilaminate fungal cell wallbioRxiv - Microbiology 2024Quote: ... After 24 h incubation at 37°C in a 5% CO2 chamber (Cytoperm 2, ThermoFisher Scientific), the culture supernatants were collected and stored at –20°C until further analysis.
-
bioRxiv - Microbiology 2024Quote: ... the peptides were sampled on a precolumn (300 μm x 5 mm PepMap C18, Thermo Scientific) and separated in a 200 cm µPAC column (PharmaFluidics) ...
-
bioRxiv - Microbiology 2024Quote: ... the TR146 cells were incubated in selective medium containing 5 μg/ml of blasticidin (Gibco, # A1113903) for 7 days ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM MgCl) with Zeba™ Spin Desalting Column with a 7 kDa MWCO (Thermo Scientific). The protein was used to prepare a serial dilution in a black 384-well ...
-
bioRxiv - Neuroscience 2024Quote: ... Slices were subsequently washed 3 x 5 minutes in PBST 0.01% (DPBS ThermoFisher, Tween P1379 Sigma), permeabilised for 15 minutes in PBST 0.5% and washed in PBST 0.01% a further three times ...
-
bioRxiv - Neuroscience 2024Quote: ... then 5 μL samples were used to coat an ELISA plate (Nunc, MediSorp, Thermo Fisher Scientific) overnight at 4°C with agitation ...
-
bioRxiv - Plant Biology 2024Quote: ... and incubated with 5 μg/mL of WGA-Alexa Fluor 488 (Thermo Fisher Scientific, MA, USA) under dark conditions for 10 min ...
-
bioRxiv - Immunology 2024Quote: ... cells were incubated for 10 min at 37°C with 5 µM CellTrace Violet (ThermoFisher Scientific). After washing ...
-
bioRxiv - Cell Biology 2024Quote: ... Transfections were performed for 5 hours in OptiMEM reduced serum media with Lipofectamine® RNAiMAX (Invitrogen). Two days after the second transfection (i.e ...
-
bioRxiv - Systems Biology 2024Quote: ... 5 U/μl RNaseOUT and 25 U/μl Superscript III (all from Thermo Fisher Scientific, USA). Samples were incubated at 50°C for 1h ...
-
bioRxiv - Plant Biology 2020Quote: ... T-DNA left border (LB) end primers (Supplemental Table 5) and DreamTaq DNA polymerase (Thermo Fisher Scientific). The cycle settings used for the TAIL-PCR reactions were adjusted based on the characteristics of the polymerase and primers used and listed in Supplemental Table 6 ...
-
bioRxiv - Microbiology 2020Quote: ... bacilliformis shifted to liquid medium at pH 7 using a 5’ RACE System kit (Invitrogen; Carlsbad, CA) according to manufacturer’s protocols and with gene-specific primers (S1 Table) ...
-
bioRxiv - Microbiology 2020Quote: ... was used at 1:4000 in 5% milk and exposed with SuperSignal West Dura substrate (Thermo Fisher).
-
bioRxiv - Biophysics 2021Quote: ... The cleared supernatant was applied onto a 5 ml ml HisPure™ Ni-NTA resin (Thermo Scientific) gravity-based column equilibrated with 10 column volumes of buffer A ...
-
bioRxiv - Cancer Biology 2021Quote: ... After washing three times with MACS buffer consisting of PBS supplemented with 5 % FCS (Thermo Fisher Scientic) and 2 mM EDTA to remove unbounded cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... and quantified using TaqMan qPCR probes for the 25 TAS2R genes and UBC1 (QuantStudio 5; ThermoFisher Scientific).
-
bioRxiv - Developmental Biology 2021Quote: ... passage 5 cells were selectively detached and dissociated into single cells using TrypLE express (Thermo Fisher Scientific) as previously described ...
-
bioRxiv - Systems Biology 2020Quote: ... Then cells were incubated with 5 μg/mL Cy5 labeled goat-anti-rabbit (Thermo Fisher Scientific; A16112) in 1% (wt/vol ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 8.3) simultaneously with a 5-fold molar excess of Alexa Fluor 647 NHS Ester (ThermoFisher, A20006) and a 5-fold molar excess of EZ-Link NHS LC-LC-Biotin (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: ... using 3–5 µg of primary antibody against each protein and protein-G magnetic Dynabeads (10003D, Invitrogen) and incubated overnight at 4°C on rotation ...
-
bioRxiv - Cell Biology 2020Quote: The 5’ and 3’ ends of lncRAP2 was determined using the FirstChoice RLM-Race Kit from Ambion following the manufacturers instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl of reverse transcription mix (50 mM Tris-HCl, pH 8.3 [Sigma], 75 mM NaCl [Ambion] ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were fixed for 5 min at room temperature with 1 % methanol-free formaldehyde (Thermo Scientific, #28906). Cells were lysed using ice-cold Farnham lab buffer supplemented with complete protease inhibitor cocktail (#4693159001 ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 a total of 10 cells were seeded on 27mm Ø Nunc Glass Base Dishes (Thermo Scientific), exchanged to 1x RINGER solution 30 minutes before imaging and the original Petri lid replaced by the compression device ...
-
bioRxiv - Cell Biology 2020Quote: Fixed HUVEC were blocked for 1hr at RT in blocking solution (5% FBS, 2X antibiotic-antimycotic (Gibco), 0.1% sodium azide (s2002-100G ...
-
bioRxiv - Cell Biology 2020Quote: MCF10A cells were cultured in Dulbecco’s Modified Eagle Medium:F12 (DMEM:F12) supplemented with 5% donor horse serum (Gibco), 10 μg/mL insulin (Actrapid ...
-
bioRxiv - Cell Biology 2020Quote: ... for 30 minutes at 37°C and 5% CO2 and counterstained with 1:10,000 Hoechst (Thermo Fisher). Parameters were set as follows ...
-
bioRxiv - Genetics 2021Quote: ... 500 µl of cell suspensions (5×105 cells/ml) were transferred to cell chambers (Invitrogen A-7816) containing coverslips treated with 0.25mg/ml concanavalin A (Sigma-Aldrich C0412 ...
-
bioRxiv - Genetics 2021Quote: ... at density of 5×103 cells/well in 100 μl DMEM-Glutamax supplemented with 10% FBS (Gibco) and penicillin-streptomycin (10 μg/ml ...
-
bioRxiv - Genetics 2021Quote: ... The sections were then incubated with Alexafluor 488-conjugated claudin-5 monoclonal antibody (4C3C2, Thermo Fisher Scientific) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... at a 1:1:1 ratio (5 mg each) using 250 ml of Opti-MEM (Gibco, 31985088) and 45 ml (1 mg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of total siRNA were transfected into macrophages using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mL pore water aliquots were fixed with 0.5 mL of 5% (w/w) ZnCl2 (Fisher Scientific). Total dissolved sulfide ...
-
bioRxiv - Microbiology 2019Quote: Copy number of the twelve markers of all isolates were determined using GeneMapper Software 5 (Applied Biosystems). Relatedness between isolates was analyzed using BioNumerics ...
-
bioRxiv - Molecular Biology 2021Quote: HAP1 cells were grown at 37°C with 5% CO2 in IMDM (Gibco; 4.5 g/L glucose) supplemented with 10% fetal bovine serum (PAN biotech) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were plated at a density of 5×104 mononuclear cells per cm2 in alpha MEM (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 5 min at RT and the signal was captured with X-ray film (Thermo Fisher, 34090) for 5-60 sec ...
-
bioRxiv - Biochemistry 2020Quote: ... pH 7.6) containing 5% milk followed by incubation with mouse Engelbreth-Holm-Swarm (EHS) laminin (ThermoFisher, 23017015) overnight at a concentration of 7.5 nM at 4°C in LBB containing 3% bovine serum albumin (BSA ...
-
bioRxiv - Biochemistry 2020Quote: HAP1 cells were maintained at 37°C and 5% CO2 in Iscove’s Modified Dulbecco’s Medium (IMDM, Gibco) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mm diameter gut punches were made and preserved in RNAlaterTM solution (Thermo Fisher Scientific Waltham, MA). RNA was extracted from tissue samples using the Qiagen RNeasy MiniKit (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were washed with PBS and then simultaneously blocked and permeabilized with 5% normal goat serum (ThermoFisher) in 0.5% Triton X-100 (Serva ...
-
bioRxiv - Developmental Biology 2020Quote: ... incubated with DAPI for 5 min in PBS and washed twice before mounting with Prolong Gold (Invitrogen). Cells were imaged on a Zeiss Imager.Z2 microscope using the ApoTome.2 structured illumination platform ...
-
bioRxiv - Immunology 2022Quote: ... The beads were washed again with PBS using magnets and resuspended in 5% Pluronic F-68 (Gibco) PBS solution and incubated for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... HCT116 cells complemented with chromosomes 3 and 5 were cultured with 400 μg/mL geneticin (G418, Gibco) and 6 ug/mL blasticidine (Invivogen) ...
-
bioRxiv - Physiology 2022Quote: ... samples were sectioned transversely at 5 μm thickness using a HM325 manual rotary microtome (Thermo Fisher Scientific). H&E staining was processed with Varistain TM Gemini ES Automated Slide Stainer (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2021Quote: ... Neurons were incubated with 5 μM Fura-2 AM and 0.04% Pluronic F-127 (Thermo Fisher Scientific) for 45-60 min at 37 °C in standard extracellular solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... Slides were then washed thrice 5 min in PBS before incubation with Nissl NeuroTrace 530/615 (Invitrogen) at 1:200 (in 3%BSA/PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse (Y2H term reverse: 5’ GGAGACTTGACCAAACCTCTGGCG) primers using Phusion High-Fidelity PCR Kit from Thermo Scientific, with a standard PCR program.
-
bioRxiv - Molecular Biology 2020Quote: ... For qPCR 5–20 ng cDNA was mixed with the Fast SYBR Green Master mix (Applied Biosystems) and amplified with a Light-cycler (Roche) ...