Labshake search
Citations for Thermo Fisher :
6401 - 6450 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... Cells were passaged every 2-3 days using 0.05% Trypsin/EDTA (Gibco™, 25300062). Cell density was 5x 104 per well for the experiments in the μ-Slide (ibidi ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 mM sodium pyruvate (Gibco™, 11360039), 1% penicillin–streptomycin (Gibco™ ...
-
bioRxiv - Systems Biology 2024Quote: ... 1% penicillin–streptomycin (Gibco™, 15140122), 0.1 mM beta-mercaptoethanol (Gibco™ 31350010 ...
-
bioRxiv - Systems Biology 2024Quote: ... Undifferentiated mESCs were cultured and maintained in the medium consisting of high glucose-Dulbecco’s Modified Eagles Medium (Gibco™, 41965039) supplemented with 15% fetal bovine serum (Gibco™ ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 mM L-glutamine (Gibco™, A2916801), 1 mM sodium pyruvate (Gibco™ ...
-
bioRxiv - Systems Biology 2024Quote: ... DAPI (10 µg/mL) (Thermo Scientific™ 62247) staining was performed together with secondary antibodies.
-
bioRxiv - Systems Biology 2024Quote: ... in 10 mM HEPES (Gibco™, 15630080) for 30 minutes at room temperature ...
-
bioRxiv - Systems Biology 2024Quote: ... Abs were first buffer exchanged into 0.2 M NaHCO3 (pH 8.3) (Thermo Scientific Acros 217125000) by using Zeba™ Spin Desalting Columns ...
-
bioRxiv - Systems Biology 2024Quote: ... 50 mM KCl (Invitrogen, AM9640G), 20% Formamide (Invitrogen ...
-
bioRxiv - Systems Biology 2024Quote: ... 2x SSC and 10% formamide (Invitrogen, AM9342). The hybridization of the probes was performed overnight at 37°C ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were washed with 2x SSC and then switch to a photo-protective buffer containing 50% glycerol (Thermo Fisher Scientific, Waltham, MA), 75 μg/mL glucose oxidase (Sigma Aldrich ...
-
bioRxiv - Systems Biology 2024Quote: ... The conjugated Abs were buffer exchanged into PBS (Gibco™ 20012019) containing 0.05% sodium azide (Sigma Aldrich ...
-
bioRxiv - Systems Biology 2024Quote: ... 1U/ µL RiboLock RNase Inhibitor (Thermo Scientific, EO0381) and 0.2 µg/µL of BSA in Nuclease-free water (Invitrogen ...
-
bioRxiv - Systems Biology 2024Quote: ... 40K MWCO (Thermo Scientific™ 87767). Abs were then reacted with 10x molar excess of dibenzocyclooctyne-S-S-N-hydroxysuccinimidyl (DBCO-S-S-NH ...
-
bioRxiv - Systems Biology 2024Quote: ... 20% Formamide (Invitrogen, AM9342), 0.2 µg/µL tRNA ...
-
bioRxiv - Biophysics 2024Quote: ... Only peak fractions with UV260/280 < 0.8 were collected and concentrated to ∼1 mg/ml determined by Nanodrop 2000 (Thermo Fisher Scientific), and aliquoted into 20 μl aliquots and flash-frozen in LN2 for storage at −80 °C until use.
-
bioRxiv - Biophysics 2024Quote: ... 1.0 U/μl SUPERase-In RNAse inhibitor (Invitrogen), 0.5 mM ATP ...
-
bioRxiv - Biophysics 2024Quote: ... 1.0 U/μl SUPERase-In RNAse inhibitor (Invitrogen), 0.5 mM ATP ...
-
bioRxiv - Biophysics 2024Quote: ... After reaction, the substrate RNAs were extracted by phenol: chloroform: isoamyl alcohol (25:24:1, v/v) (Invitrogen), precipitated by ethanol ...
-
bioRxiv - Biophysics 2024Quote: ... The gel was run in 0.5x TBE buffer at 120 V for 42 min and stained with 1x SYBR™ Gold Nucleic Acid Gel Stain (Invitrogen) diluted with 0.5x TBE buffer for 20 min ...
-
bioRxiv - Biophysics 2024Quote: ... Cells were cultured in DMEM (Gibco by Life Technologies) with 1% penicillin/streptomycin ...
-
bioRxiv - Biophysics 2024Quote: ... Cells were cultured in DMEM (Gibco by Life Technologies) with 1% penicillin/streptomycin ...
-
bioRxiv - Biophysics 2024Quote: ... The substrate RNAs were stained with 1x SYBR™ Gold Nucleic Acid Gel Stain (Invitrogen) diluted with 1x TBE buffer for 10 min ...
-
bioRxiv - Biophysics 2024Quote: ... SLBs were formed by vesicle fusion of SUVs by adding this spreading solution to Attofluor imaging chambers (Cat #: A7816 by Invitrogen, ThermoFisher Scientific) assembled with freshly piranha-etched glass coverslips (Thomas Scientific ...
-
bioRxiv - Biophysics 2024Quote: Cells were grown to confluence in T75 tissue flasks (Thermo scientific) and synchronized in interphase ...
-
bioRxiv - Biophysics 2024Quote: ... monitored using a 7900HT Fast Real Time PCR System (Applied Biosystems). The fluorescence was normalized based on the peak value ...
-
bioRxiv - Cancer Biology 2024Quote: ... raw data files were searched using Mascot (Matrix Science) and Proteome Discoverer (ThermoFisher Scientific, Inc). with a publicly available non-redundant human proteome database (Swiss-Prot ...
-
bioRxiv - Biophysics 2024Quote: ... 200 U RNAse cocktail enzyme mix (Invitrogen) and 0.25 mmol MgCl2 were added per liter of cell culture ...
-
bioRxiv - Biophysics 2024Quote: ... and 10% fetal bovine serum (Gibco by Life Technologies). Cell culture was carried out in polystyrene T75 culture flasks (Thermo Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... and the entire 10 μl RNA–protein mixture was then loaded onto DNA Retardation Gels (6%) (Invitrogen) with 2.5 μl Novex™ Hi-Density TBE Sample Buffer (5X ...
-
bioRxiv - Biophysics 2024Quote: ... IMR90 and HEK293T cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and 100 units ml−1 penicillin and 100 µg ml−1 streptomycin (Invitrogen). IMR90 cells were cultured under physiological oxygen (3%) ...
-
bioRxiv - Biophysics 2024Quote: ... Recombinant CtNAT10 protein was expressed in both Sf9 cells (ThermoFisher, cat #12659017) and homemade bGroESL cells (See Experimental Model and Subject Details) ...
-
bioRxiv - Biophysics 2024Quote: All thermal shift experiments were performed using the Protein Thermal Shift Dye Kit (Thermo Fisher Scientific) and following the standard commercial protocol with an Applied Biosystems QuantStudio 3 Real-Time PCR system ...
-
bioRxiv - Biophysics 2024Quote: ... Elution fractions were dialyzed overnight in 1 x PBS and 2 mM EDTA using 10 kDa MWCO dialysis cassettes (Cat # 66380, ThermoFisher Scientific, Waltham, MA).
-
bioRxiv - Biophysics 2024Quote: ... CD4+ cells were isolated using DynabeadsTM UntouchedTM Mouse CD4 Cell Kit (Cat #: 11416D, ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... and 10% fetal bovine serum (Gibco by Life Technologies). Cell culture was carried out in polystyrene T75 culture flasks (Thermo Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... and analyzed by 10% TBE-Urea Gel (Invitrogen). The substrate RNAs were stained with 1x SYBR™ Gold Nucleic Acid Gel Stain (Invitrogen ...
-
bioRxiv - Biophysics 2024Quote: ... SLBs were formed by vesicle fusion of SUVs by adding this spreading solution to Attofluor imaging chambers (Cat #: A7816 by Invitrogen, ThermoFisher Scientific) assembled with freshly piranha-etched glass coverslips (Thomas Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... and streptomycin (100 µg/ml) (Life Technologies) in a humidified incubator at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... on a QuantStudio 5 Real-Time PCR system (Applied Biosystems). The target mRNA expression was quantified using the ΔΔCt method and normalized to the expression of the housing keeping gene ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing the guide sequence (CTTGGTATCGAAGCACAAGC or ACTTTGCAGCCGTCATCGGG) targeting exon 1 of CDK12 using Lipofectamine 3000 (Thermo Fisher) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 10% bovine calf serum (BCS) (Thermo Fisher Scientific), 50 mM GlutaMAX (Life Technologies) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Proteins were separated by NuPAGE 3-8% or 4-12 % Tris-Acetate Midi Gel (Invitrogen, Cat# WG1402BX10) and transferred to nitrocellulose membranes (Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... the protein was dialyzed in 0.5x PBS using a Slide-A-Lyzer Dialysis Cassette (Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2024Quote: ... The samples were subjected to 6 rounds of 10 sec sonication each at power 3 in a 550 Sonic Dismembrator (Fisher Scientific). Between each round of sonication ...
-
bioRxiv - Cancer Biology 2024Quote: ... After three washes with 1 X TBS (ThermoFisher, Cat J75892-K8 pH7.4) containing 0.1% Tween-20 (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... and cDNA was synthesized following Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) instructions ...
-
bioRxiv - Biophysics 2024Quote: ... the homogenized SVs were drawn first through a 20-gauge hypodermic needle (Fisher Scientific, 0556121) attached to a 10-ml syringe ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 1 hour at 37°C followed by TryLE (Gibco) digestion ...
-
bioRxiv - Cancer Biology 2024Quote: ... and supplemented with EDTA-free protease Inhibitor Cocktail (Thermo Fisher Scientific). The samples were subjected to 6 rounds of 10 sec sonication each at power 3 in a 550 Sonic Dismembrator (Fisher Scientific) ...