Labshake search
Citations for Thermo Fisher :
6251 - 6300 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Digested peptides were eluted through centrifugation and labeled using commercially available TMTsixplex tags (ThermoFisher, P/N 90061). After labeling ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein Thermal Shift dye and Tris buffer according to the Protein Thermal Shift™ Dye Kit (ThermoFisher Scientific) protocols ...
-
bioRxiv - Biochemistry 2024Quote: ... Individual samples were then labeled with isobaric tags using commercially available TMTsixplex (Thermo Fisher Scientific, P/N 90061) kits ...
-
bioRxiv - Biochemistry 2024Quote: ... Plates were then prepared using 18 μL of a 1.11 × master mix according to the Protein Thermal Shift™ Dye Kit (ThermoFisher Scientific).
-
bioRxiv - Biochemistry 2024Quote: ... The soluble proteome was then diluted with 5 mL of PBS and further incubated with high-capacity streptavidin-agarose beads (100 μL/sample, ThermoFisher Scientific, 20357). Beads and lysates were incubated overnight at 4 °C with rotation ...
-
bioRxiv - Biochemistry 2024Quote: ... following which protein concentration was determined using a NanoDrop Onec Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific) using the predicted molar extinction coefficient from ProtParam (91,790 M⁻¹ cm⁻¹).
-
bioRxiv - Biochemistry 2024Quote: ... each ligand was prepared at 100 mM in Tris buffer and 2 μL was aliquoted into MicroAmp Optical 96-Well Reaction Plates (ThermoFisher Scientific). Plates were then prepared using 18 μL of a 1.11 × master mix according to the Protein Thermal Shift™ Dye Kit (ThermoFisher Scientific).
-
bioRxiv - Biochemistry 2024Quote: Lentiviral stable knockdown generation was done by growing HEK293T packaging cells in DMEM high glucose supplemented with 10% FBS and after 24 h were transfected with viral components and shRNA against target genes (or scrambled control) using Lipofectamine 2000 (Invitrogen, 11668–019), grown and concentrated using Lenti-X Concentrator (Clontech Laboratory ...
-
bioRxiv - Biochemistry 2024Quote: ... Puromycin (Fisher Scientific, BP2956-100; 4 ug/ml) was used as selection agent ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 μL of PCR products was run on a 2% E-gel EX Agarose Gel (ThermoFisher #G401002) for 10 minutes according to the settings programmed into the gel system ...
-
bioRxiv - Biochemistry 2024Quote: ... with a replacement in the N-terminal domain loop 8 (139CQKRDGPH146 to 139AEAG142, designated as rA3GR8) was constructed in the pET-sumo vector (Thermo Fisher Scientific). This construct generated a SUMO fusion with an N-terminal 6xHis tag and a PreScission protease cleavage site ...
-
bioRxiv - Biochemistry 2024Quote: ... and mounted with the ProLong Diamond Antifade (Invitrogen) mounting medium on glass slides.
-
bioRxiv - Biochemistry 2024Quote: ... and 19 μL of RNase-free UltraPure water (ThermoFisher #10977015). The reaction was run in the thermocycler with an initial denaturation for 2 minutes at 94 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction was quenched 6 minutes after DMS with 25 μL of BME (ThermoFisher cat. #125470010) to the solution ...
-
bioRxiv - Biochemistry 2024Quote: ... with custom TaqMan gene expression systems from Applied Biosystems, CA using primers and probes ...
-
bioRxiv - Biochemistry 2024Quote: 384-well plates were coated with 2 µg/ml of streptavidin (Thermo Fisher Scientific, MA), followed by blocking ...
-
bioRxiv - Biochemistry 2024Quote: The amount of cholesterol in the cell ER fractions was evaluated through Amplex cholesterol Assay kit (Invitrogen A12216) following the manufacturer instructions.
-
bioRxiv - Biochemistry 2024Quote: ... Protein quality was assessed by SDS-PAGE using NuPage 4-12% (Invitrogen, CA). The purified proteins were flash frozen and stored at −80°C in single-use aliquots ...
-
bioRxiv - Biochemistry 2024Quote: ... gels were stained with 1X SYBR™ Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific) for 10 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... an oligo (dT)20 primer and Superscript III RT (Invitrogen, CA). Gene expression of SmNPP5 or SmAP was measured by quantitative real time PCR (RT-qPCR) ...
-
bioRxiv - Biochemistry 2024Quote: ... coli (Thermo Fisher Scientific, MA), using standard techniques ...
-
bioRxiv - Biochemistry 2024Quote: ... Ube2d2 and Ube2d2S22R were fluorescently labelled with FITC following the manufacturer instructions provided in the FITC labelling kit (Thermo Fisher Scientific). For the analysis of UbV-Ube2d2-FITC complexes ...
-
bioRxiv - Biochemistry 2024Quote: ... peptides were resuspended in MS loading buffer (0.1% (v/v) TFA in 2% (v/v) ACN) and the concentration was measured with a NanoDrop Spectrophotometer (Thermo Fisher Scientific) in order to normalize injections to 200 ng of peptides.
-
bioRxiv - Bioengineering 2024Quote: ... they were PCR amplified using Accuprime Pfx (Invitrogen) as follows ...
-
bioRxiv - Bioengineering 2024Quote: Expi293F cells (A14527 Gibco) were grown in a humidified 8% CO2 incubator ...
-
bioRxiv - Bioengineering 2024Quote: ... then dissociated into a single-cell suspension by incubating in TrypLE (12604021, Gibco) at 37°C for 30 min with frequent mixing by pipetting ...
-
bioRxiv - Bioengineering 2024Quote: ... while hBTEC-ALI cultures were collected in 300 µL of Trizol™ Reagent and RNA extracted by phenyl-chloroform method according to manufacturers’ protocol (ThermoFisher Scientific). All experiments were performed three independent times ...
-
bioRxiv - Bioengineering 2024Quote: ... NucBlue (ThermoFisher, R37605) was also used to track live cells along with lectin-bound mucin components.
-
bioRxiv - Bioengineering 2024Quote: The organoids were monitored as needed with a high-throughput imaging system (Thermo Scientific, EVOS FL Auto 2). At days 3-4 of organoid seeding and every three days thereafter ...
-
bioRxiv - Bioengineering 2024Quote: ... A cryostat (Thermo Scientific, CryoStar NX70) at the histology core of the Parker H ...
-
bioRxiv - Bioengineering 2024Quote: Alexa Fluor 488 donkey anti-goat (Invitrogen, A11055)
-
bioRxiv - Bioengineering 2024Quote: ... Antibodies were purified by gravity column using Protein G Sepharose 4 Fast Flow Resin (Cytiva) and proteins containing His tags were purified on Ni-NTA Agarose (R90101 Invitrogen).
-
bioRxiv - Bioengineering 2024Quote: ... an appropriate volume of methylcellulose was added (0.24% final concentration at the target volume)and the solution warmed in a 37°C bead bath (Fisher Scientific, GSGPD10). Once warm ...
-
bioRxiv - Bioengineering 2024Quote: ... AORBs were then washed three times with 1X PBS (Gibco, 10010), with 2-3 minutes between washes ...
-
bioRxiv - Bioengineering 2024Quote: mouse Anti-ITGϕ34 (ThermoFisher, MA5-17104; 1:100)
-
bioRxiv - Bioengineering 2024Quote: ... in distilled water (diH2O) (Gibco, 15230). On the day of organoid seeding ...
-
bioRxiv - Bioengineering 2024Quote: ... The HD plate was kept in a cell culture incubator (Thermo Scientific, VIOS 160i) with 5% CO2 injection at 37°C.
-
bioRxiv - Bioengineering 2024Quote: Cell viability and density were measured using a Countess II FL Automated Cell Counter (Invitrogen). DNA for transfection was purified using EndoFree Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Bioengineering 2024Quote: Total cellular RNA was isolated from leaves frozen in liquid nitrogen using TRIzol (Thermo Fisher Scientific, Waltham, MA), following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... incubated for 1 hr with secondary antibody (HRP-conjugated goat anti-rabbit; Invitrogen, 656120) at room temperature ...
-
bioRxiv - Bioengineering 2024Quote: Alexa Fluor 647 anti-rabbit (Invitrogen, A31573)
-
bioRxiv - Bioengineering 2024Quote: Alexa Fluor 568 anti-mouse (Invitrogen, A10037)
-
bioRxiv - Bioengineering 2024Quote: Alexa Fluor 488 donkey anti-rat (Invitrogen, A21208)
-
bioRxiv - Bioengineering 2024Quote: ... Wells were blocked for 1 hour in Pierce™ clear milk blocking buffer (ThermoFisher, #37587), incubated with primary antibody against spike protein diluted 1:5,000 in blocking buffer (Elabscience ...
-
bioRxiv - Bioengineering 2024Quote: ... AORBs were fixed in 4% PFA (Thermo Scientific, J61899-AP) in PBS for 30 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR primers (F primer 5’ agatcagatctttgtcgatcctacca 3’ and R primer 5’tcatctcccggggttgtggc 3’) were used to amplify the entire first cistron and IRES using Accuprime Pfx (Invitrogen) for 30 cycles ...
-
bioRxiv - Bioengineering 2024Quote: ... Transfections were performed using Lipofectamine 3000 (Invitrogen Cat#L3000001) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 mM sodium pyruvate (Invitrogen, Thermo Fisher Scientific), 100 U/mL penicillin (Invitrogen ...
-
bioRxiv - Bioengineering 2024Quote: ... 100 U/mL penicillin (Invitrogen, Thermo Fisher Scientific), and 100 μg/mL streptomycin (Invitrogen ...
-
bioRxiv - Bioengineering 2024Quote: To adhere 500 nm diameter yellow-green fluorescent beads (ThermoFisher Scientific, F8813) to #1.5 coverslips (Thorlabs ...