Labshake search
Citations for Thermo Fisher :
5901 - 5950 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2019Quote: ... cDNA was prepared using oligo(dT) primers and the SuperScript III reverse transcriptase (Invitrogen) following the manufacturer’ s instructions ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was amplified using ISPCR primer (AAGCAGTGGTATCAACGCAGAGT) and KAPA HiFi HotStart ReadyMix (Fisher Scientific), cleaned up using RNAClean XP SPRI beads three times ...
-
bioRxiv - Developmental Biology 2020Quote: ... using High Capacity Reverse Transcription Kit with random primers (Applied Biosystems, Cat No. 4368814). Amplification was performed in triplicate in an Applied Biosystems 7500 Real-Time PCR System machine using Power Up SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Bioengineering 2020Quote: ... using Taqman primers and a Taqman fast advanced master mix (Applied Biosystems, California, USA). Primers can be found listed in Table 1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 500 ng total RNA was transcribed into cDNA using random hexamer primers (Thermo Scientific) and the RevertAid Reverse Transcriptase (Thermo Scientific ...
-
bioRxiv - Immunology 2019Quote: ... The primers for ACTB are assay Hs99999903 and for MRC1 are assay Hs00267207 (ThermoFisher). Reactions were quantified using ABI Sequence Detection software compared to serial dilutions of cDNA from mock-treated cells ...
-
bioRxiv - Cell Biology 2020Quote: ... and cDNAs were generated with random primers and SuperScript III Reverse Transcriptase (Life Technologies). Real-time quantitative PCR reactions were performed with StepOnePlus Real-Time PCR system (Life Technologies ...
-
bioRxiv - Physiology 2021Quote: ... 250 nM of each primer and 1X PowerUp SYBR Green Master Mix (Applied Biosystems). The program used was ...
-
bioRxiv - Physiology 2021Quote: ... First-strand cDNA was transcribed using random primers and SuperScript II Reverse Transcriptase (Invitrogen). Real-time quantitative PCR was performed using ABsolute SYBR Green ROX mix (Thermo Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... and 900nM primers in a QuantStudio 6 Real-Time system (Thermo Fisher Scientific, US) with standard cycling and dissociation curve analysis ...
-
bioRxiv - Microbiology 2021Quote: ... confirmed with overlapping sense and antisense primers by Sanger sequencing (SeqStudio, Thermo Fisher Scientific) using the BigDye Terminator v.3.1 Cycle Sequencing and XTerminator Purification kits (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... Primer efficiencies were determined using the manufacturer’s protocol (Applied Biosystems Inc. User Bulletin #2). clpX and recA were used as the two internal standards ...
-
bioRxiv - Neuroscience 2020Quote: ... One μg of RNA was used for cDNA synthesis with random hexamer primers (Invitrogen) and SuperScript III reverse transcriptase (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... Purified RNA was reverse-transcribed using Superscript II enzyme and random hexamer primers (Invitrogen). Taqman probes for genes of interest were purchased from Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... using the primers shown in Table II and cloned into pcDNA-V5/His (Invitrogen). pCAGGS-EboGP-V5 (strain Zaire 1976 Mayinga ...
-
bioRxiv - Immunology 2021Quote: ... following the manufacturer’s instructions and with Rhesus-specific TaqMan gene expression primers (Life Technologies). Eukaryotic 18S rRNA (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... and custom-made primers (Table S6) using an ABI Prism 7900 system (Applied Biosystems). For gene expression normalization ...
-
bioRxiv - Bioengineering 2020Quote: ... SYBR green assays were designed using the program Primer Express v 2.0 (Applied Biosystems) with default parameters ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse transcription was carried out with random hexamer primers (S0142-Thermo Scientific™) using SuperScript™ III Reverse Transcriptase (18080-044-Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized with Oligo(dT) primer and Superscript IVReverse Transcriptase (Thermo Fisher Scientific). PCR was performed with T100 thermal cycler (Bio-Rad Laboratories ...
-
bioRxiv - Genomics 2022Quote: ... RNA was reverse transcribed using random primers and SuperScript IV Reverse Transcriptase (Invitrogen, 18090010). Quantitative real-time PCR was performed on the ViiA 7 system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the complementary DNA was synthetized using random hexamer primers (SO142, Thermo Fisher Scientific). The full-length TLN1 was inserted into a pEGFP-N2 vector using the In-Fusion HD cloning kit (Takara Bio USA) ...
-
bioRxiv - Physiology 2024Quote: ... and oligo primers for target genes and carried out on QuantStudio 3 (Applied Biosystems). Transcripts of SOCE and Ca2+ signaling related proteins were quantified in quadriceps muscles from 6 months old WT and C3KO mice ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNAs and qPCR primers were combined with 2X SYBR master mix from Thermo Fisher for qPCR ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µM PAGE-purified primers and one unit of Platinum Taq DNA polymerase (Invitrogen). qPCR signal from a mock control lacking antibody was measured to determine the efficiency of recruitment ...
-
bioRxiv - Physiology 2024Quote: ... (2023) using Primer Express software version 3.0 (Applied Biosystems, ThermoFisher Scientific, Wilmington, DE, USA).
-
bioRxiv - Molecular Biology 2024Quote: ... 500 ng of RNA were reverse transcribed using random hexamer primers (Thermo Fisher Scientific) and AffinityScript reverse transcriptase (Agilent) ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA and relevant primers were mixed with PowerUp SYBR green master mix (Applied Biosystems), and using SYBR green reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription was performed after incubation of mRNA with Random Primers (ThermoFisher Scientific, 48190011) for 5 minutes at 70°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... For the expression analysis of globins in human cells predesigned TaqMan primers (Applied Biosystems) were used in conjunction with Taqman Universal Master Mix II (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNAs were synthesized using random hexamer primers and the Versco cDNA kit (ThermoFisher, AB1453B) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: cDNA was generated from total RNA with specific primers using Superscript III (Life Technologies). For the RT-PCR experiments (not quantitative) ...
-
bioRxiv - Genomics 2024Quote: ... and reverse-transcribed via random primers using the Verso cDNA synthesis kit (Thermo Scientific). All 1,252 clinical blood samples passed QC ...
-
bioRxiv - Microbiology 2023Quote: ... Smart-dTV30 primer (IDT) and ERCC RNA Spike-in Mix (cat. no. 4456740, ThermoFisher) diluted 4·105 times ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA and relevant primers were mixed with PowerUp SYBR green master mix (Applied Biosystems), and real-time PCR was performed using the 7500 Fast real-time PCR system ...
-
bioRxiv - Molecular Biology 2023Quote: ... then reverse transcribed with oligo(dT)12-18 primers and SuperScript IV enzyme (Invitrogen). The OR genes were amplified with gene-specific primers containing an AscI recognition sequence on both primers (except SwaI for OR19a ...
-
bioRxiv - Neuroscience 2023Quote: ... total RNA was reverse-transcribed to cDNA with T7 oligo d(T) primer (Affymetrix). Next ...
-
bioRxiv - Molecular Biology 2023Quote: ... then biotinylated primers and products were bound to MyOne C1 streptavidin-coated microbeads (Invitrogen) prewashed thrice in BWBT ...
-
bioRxiv - Microbiology 2022Quote: ... and the primer extension products were separated on a 15% denaturing polyacrylamide gel (Invitrogen). After electrophoresis ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was synthesized using random primers and Superscript III Reverse Transcriptase (Thermo Fisher Scientific). Genomic DNA or cDNA were mixed with primers (see Supplementary Table 5 ...
-
bioRxiv - Microbiology 2023Quote: ... and then converted to cDNA using random primers (250ng/uL) (Invitrogen, Cat. No. 48190011) and SuperScript II reverse transcriptase (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: ... and custom-made primers (Table S4) using an ABI Prism 7900 system (Applied Biosystems). For gene expression normalization ...
-
bioRxiv - Neuroscience 2023Quote: ... and converted to cDNA using oligod(T) primers and Superscript II reverse transcriptase (Invitrogen). Gene expression was determined by quantitative real-time PCR using QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Flag-tag primer is GATTACAAGGATGACGACGATAAG) for 36 hours in Opti-MEM (31985062, Thermo Fisher) medium with 10 µL GeneTran III reagent (GT2211 ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 µL of random primer (Invitrogen/Thermo Fisher, Cat. No. 48190011, Waltham, MA, USA), 0.5 µL of Oligo dT primer (Invitrogen/Thermo Fisher ...
-
bioRxiv - Biochemistry 2023Quote: ... Forward and reverse mutagenesis primers containing the single point mutations were purchased from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR was performed using 2 uL of cDNA and primers for 18S (ThermoFisher #Hs03003631), Pax3 (ThermoFisher #Bt04303789) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and was reverse-transcribed into complementary DNA with random hexamer primer (Thermo Fisher Scientific). qRT-PCR was performed in triplicates using QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: DNA primers for the site-directed mutagenesis of ShPyV VP1 were ordered from ThermoFisher Scientific and are displayed from 5’-to 3’ ends:
-
bioRxiv - Cell Biology 2022Quote: ... The qPCR primers were purchased as pre-optimized reagents (Applied Biosystems/Life Technologies, Inc.) and the TaqMan One-Step RT-PCR kit was used to perform all reactions ...