Labshake search
Citations for Thermo Fisher :
5101 - 5150 of 5976 citations for M CSF Rat HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Tubes had equal amounts of glycerol and 0.04 M phosphate buffer (pH 7.2–7.6) containing 1× antibiotic–antifungal mixture (Thermo-Fisher Scientific, Johannesburg, South Africa) (46,47) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the lysate volume was increased to 1 ml and 8 μg of antibody were used in combination with Protein G Dynabeads M-280 (Thermo Scientific) as described above ...
-
bioRxiv - Cell Biology 2022Quote: Each CDM pellet was resuspended in 100 mM NH4HCO3 solution containing 8 M urea and 10 mM dithiothreitol (DTT; Thermo Fisher) and incubated at 37 °C for 2 hours under agitation ...
-
bioRxiv - Genomics 2020Quote: ... the three samples (LETR1-Odd, LETR1-Even, and LacZ) were pulled down using 120µL Dynabeads M-270 streptavidin magnetic beads (Thermo Fisher Scientific) for 30min at 37°C with rotation ...
-
bioRxiv - Immunology 2019Quote: ... BMDCs were then plated at 2×105 cells per well in 96 well U-bottom tissue culture plates and 3×105 thymocytes stained with 0.5□M eFluor670 (Thermo Fisher Scientific) were added per well ...
-
bioRxiv - Neuroscience 2019Quote: ... containing either 350 μL dH2O added to a piece of Kim wipe (starved condition) or 350 μL of 0.2 M sucrose (Acros Organics #177140050) added to a piece of Kim wipe (non-starved condition).
-
bioRxiv - Bioengineering 2019Quote: ... Microscopy images for tdTomato and zsGreen fluorescence were taken of the 10-μ;m sections using an EVOS FL Auto 2 Imaging System (Invitrogen, Thermo Fisher Scientific Inc. ...
-
bioRxiv - Developmental Biology 2019Quote: The following chick plasmids were used to generate Digoxigenin–labeled antisense probes: Etv4 (a kind gift from M. Bronner) Spry1 obtained from Life Technologies Klf7 ChEST376015 ...
-
bioRxiv - Cell Biology 2019Quote: ... Confocal channel shift alignment and STORM point spread function (PSF) calibration and channel shift alignment were performed using 0.1μ m TetraSpeck fluorescent beads (Invitrogen, cat#T7279).
-
bioRxiv - Neuroscience 2020Quote: ... 10 μm thick spinal cord and 20 μm thick brain and liver sections were sectioned on cryostat at -20°C and slide-mounted (Superfrost Plus Slides, Fisher Scientific). Slides were stored at -20°C until used.
-
bioRxiv - Genomics 2021Quote: ... and the 30% volume of the purified PCR products was used for streptavidin capture with M-280 Dynabeads (Thermo Fisher Scientific) according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... 500mM NaCl using 5μg of mouse anti-DMC1 2H12/4 (Novus NB100-2617) pre-bound to 50μl of Dynabeads™ M-280 sheep anti-mouse IgG (Life Technologies).
-
bioRxiv - Genetics 2019Quote: ... the sonicate was pre-cleared for 2h at 4°C with 65μl of Dynabeads™ M-280 sheep anti-rabbit IgG (Life Technologies) and a 1% input chromatin sample was set aside ...
-
bioRxiv - Genomics 2020Quote: ... Relative transcript levels of the β-lactamase encoding genes (blaOXA-1 and blaCTX-M) were assayed using TaqMan reagents on the StepOne Plus Real Time PCR machine (Applied Biosystems). The transcript level of blaOXA-1 and blaCTX-M were determined relative to the endogenous control gene rpsL (36 ...
-
bioRxiv - Biophysics 2021Quote: ... between 0.5-2 mg of individual histones were combined and dialyzed into 2 M NaCl (10 K MWCO, 3-12 mL Slide-A-Lyzer Dialysis Cassettes, ThermoFisher Scientific). After dialysis the histones in 2 M NaCl were concentrated to a volume of 1 mL and purified using an Superdex 200 column (GE Healthcare ...
-
bioRxiv - Biophysics 2021Quote: ... and biotin-PEG-SVA at a ratio of 99:1 (w/w) (Laysan Bio) in 0.1 M sodium bicarbonate (Thermo Fisher Scientific) for 3 h.10 Excess PEG was rinsed with water ...
-
bioRxiv - Biochemistry 2020Quote: ... Peptides were resolved using a 12 cm 75 µm column with 3 µm C18 particles (Nikkyo Technos Co., Ltd. Japan) coupled to a Fusion Lumos mass spectrometer (Thermo Scientific) operated in high/high mode ...
-
bioRxiv - Neuroscience 2020Quote: ... Slices were washed (3x for 5 minutes at room temperature while shaking) with 0.1 M PBS and 0.1% Triton-X-100 (Acros Organics, AC21568-2500), then nutated in blocking solution containing normal goat serum (Millipore Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... slides were washed 3 x 5 min with PBS-TX and once with 0.1 M phosphate buffer pH 7.4 (0.08 M sodium phosphate dibasic and 0.02 M sodium phosphate monobasic) prior to coverslipping with ProLong Gold antifade reagent with 4’,6-diamidino-2-phenylindole [DAPI] (Invitrogen, P36931).
-
bioRxiv - Cell Biology 2021Quote: Human PCNT siRNA (Smart Pool) (M-012172-01-0005; Dharmacon) was transfected into cells with Lipofectamine RNAi MAX (13778100; ThermoFisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2021Quote: DNA-PAINT imaging was performed in Buffer C (2.5 M NaCl; S7653, Sigma-Aldrich in 5x PBS; 14200-059, Gibco Fisher Scientific) supplemented with 1 mM ethylenediaminetetraacetic acid (EDTA ...
-
bioRxiv - Cell Biology 2021Quote: Human PCNT siRNA (Smart Pool) (M-012172-01-0005; Dharmacon) was transfected into RPE1 cells with Lipofectamine RNAi MAX (13778100; ThermoFisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... 20 μL of homogenate was dried under air and redissolved in 20 μL of M-PER buffer (Thermo Fisher Scientific, 78501) for protein estimation with BCA assay ...
-
bioRxiv - Cell Biology 2021Quote: ... with 0.4 µm pore size in 6 well plates with 1 ml Slice Culture Medium as follows: 50% MEM with GlutaMAX (Gibco, 41090036) 18% EBSS ...
-
bioRxiv - Molecular Biology 2020Quote: ... with the following modifications for likely partially degraded samples with an expected low target viral content: 50uL Dynabeads® M-270 Streptavidin beads (Invitrogen) instead of 30 uL Dynabeads® MyOne™ Streptavidin C1 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The beads were washed five times with lysis buffer containing 1 M NaCl and incubated with 25 µl of biotin elution buffer (lysis buffer with 5 mM D-biotin [Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Prior to the addition of 74.5 µL of 1 M DTT and 187.5 µL NuPAGE™ LDS Sample Buffer (4X) (Thermo Fisher Scientific), cells were further mechanically disrupted by passing the lysate through a 26g size needle ...
-
bioRxiv - Microbiology 2021Quote: ... The peroxidase reaction was terminated by adding 50 μL of H2SO4 (1 M) before the final optical density (OD) was taken using an ELISA plate reader (Multiskan Go, Thermo Scientific) at the wavelength of 450 nm ...
-
bioRxiv - Plant Biology 2020Quote: Gene expression analysis by RT-qPCR was performed using RNA extractions which generated cDNA using the REVERSE TRANSCRIPTASE M-MLV Kit Supplied by Life Technologies Ltd ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μM E64D) and incubated for 1 h in CCF2 solution (LB, CCF2-AM, Solution B [CCF2-AM kit K1032] Thermo Fisher) in the dark ...
-
bioRxiv - Microbiology 2020Quote: ... in 20 mL of 0.2 μm-filtered lake water with the addition of 0.8 M urea in closed 50-mL glass serum bottles with agitation (90 rpm, orbital shaker MaxQTM 2000, Thermo Fisher Scientific) at room temperature and under natural light cycles for 12 days ...
-
bioRxiv - Microbiology 2020Quote: ... Peptides were sampled on a 300 μm x 5 mm PepMap C18 precolumn and separated on a 75 μm x 250 mm C18 column (PepMap, Thermo Scientific) using a 120-min gradient ...
-
bioRxiv - Cancer Biology 2020Quote: The cDNA was synthesized from 1 μg of purified RNA derived from A549 cells using M-MLV reverse transcriptase according to manufacturer’s recommendations (Invitrogen, Carlsbad, CA). The housekeeping gene GAPDH was used as a reference for normalization (primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... an amount of 10 µg peptides was dried and resuspended in 10 µL 0.2 M EPPS (pH 8.2) / 20% ACN and the respective TMT10 reagent (Thermo Fisher Scientific, 1862804) in a TMT:peptide ratio of 2.5:1 was added ...
-
bioRxiv - Cell Biology 2021Quote: ... and the pellets were dissolved in 0.1% SDS/ 0.67 M Tris-HCl pH 8 +/- 15 mM 4-acetamido-4’-maleimidylstilbene-2,2’-disulfonic acid (Thermo Fisher Scientific, USA). The samples were incubated at 37 °C for 2 h ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 x 10 min washes in 0.01 M PBS were followed by incubations in AF568-conjugated donkey anti-goat (Invitrogen; 1:400) and AF488-conjugated donkey anti-guinea pig (Jackson ImmunoResearch ...
-
bioRxiv - Cell Biology 2021Quote: ... The cell pellets were rinsed in phosphate-buffered saline and dissolved in M-PER mammalian protein extraction reagent (ThermoFisher Scientific, www.thermofisher.com) containing mini protease inhibitor cocktail (Sigma Chemicals) ...
-
bioRxiv - Microbiology 2022Quote: ... Parasite proteins were reduced with 200 □M dithiotreitol (DTT) and separated on 4-12% NuPAGE Bis-Tris gels (Thermo Fisher Scientific). Following wet protein transfer to nitrocellulose ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... solution was prepared by diluting a solution containing 10 mass-labeled PFAS in water with 0.1 M formic acid (99.5%, A117-50, Fisher Scientific, Waltham, MA): 18O2-PFBS,13C4-PFBA ...
-
bioRxiv - Molecular Biology 2022Quote: The ubiquitylated yeast CMG was then incubated for 30 minutes at 4°C with 2.5 µl (per 10 µl ubiquitylation reaction mix) magnetic beads (Dynabeads M-270 Epoxy; Life Technologies, 14302D) that had been coupled to anti-FLAG M2 antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... Brain slices were collected and stored in 0.02% sodium azide in PBS (0.1 M) and mounted on Superfrost Plus Microscope Slides (Fisherbrand – Fisher Scientific, Pittsburgh, U.S.A), coverslipped ...
-
bioRxiv - Physiology 2022Quote: ... Ten microliters of recombinant FLAG-mGCNA or FLAG-mSPRTN E113Q from cell-free extracts and 500 μg of Dynabeads M-280 Streptavidin (catalog no. 11205D, Themo Fisher Scientific) with immobilized ssDNA or dsDNA were incubated in 440 μl binding buffer (25 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 μm C 18 beads (Nikkyo Technologies, NTCC-360/75-3-123°Column) with buffer A: 0.1% formic acid (Fisher Scientific, A11750), and buffer B ...
-
bioRxiv - Genetics 2022Quote: ... Quantitative RT-PCR reactions for viral load were achieved using pan-IAV M gene primers and probes (forward: GACCRATCCTGTCACCTCTGAC, reverse: AGGGCATTYTGGACAAAKCGTCTA, probe: TGCAGTCCTCGCTCACTGGGCACG) with the TaqMan Universal Master Mix II (Applied Biosystems) and 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Genetics 2022Quote: ... using Acquity UPLC M-Class System (Waters, USA) on line with Orbitrap Fusion Lumos Tribrid Mass Spectrometer (Thermo Fisher Scientific, USA). The column was held at 45°C ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were co-cultivated in a volume of 25 μl M-199 medium supplemented with 10% FBS (Gibco, Thermo Fisher Scientific), endothelial growth supplement (20 μg/ml ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were co-cultivated in a volume of 25 μl M-199 medium supplemented with 10% FBS (Gibco, Thermo Fisher Scientific), endothelial growth supplement (20 μg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: Protein extracts were collected in 9 M urea lysis buffer and quantified using the Pierce Rapid Gold BCA Protein Assay Kit (Thermo Fisher). Protein samples were fractionated with SDS-PAGE using Bolt 4-12% Bis-Tris Plus Gels (Thermo Fisher ...
-
bioRxiv - Immunology 2022Quote: 90μL of paraformaldehyde fixed cells was incubated with 5 x 10-7 M DAPI and 1:100 Vybrant™ DiD Cell-Labeling Solution (Invitrogen) at 37C for 20 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... The flow-through was transferred to two 1.5-ml tubes (each containing 250 μl flow-through) and 625 µl ethanol, 25 µl NaAc (3 M, pH 5.0) and 1 µl glycogen (Invitrogen, Cat. 10814010) was added ...