Labshake search
Citations for Bio-Rad :
8651 - 8700 of 10000+ citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Protein concentrations of the cellular extracts were determined using the DC Protein Assay (ref 5000112, Bio-Rad, Hercules, California, USA). Equal amounts of proteins (20 μg ...
-
bioRxiv - Biochemistry 2024Quote: All fluorescence-based detection assays were carried out in a CFX96 touch real-time PCR system (Bio-Rad, CA, USA). The Cas12a ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Total protein (mg/mL) was determined for each sample using Bradford assay reagent (Catalogue # 5000002, Bio-Rad, Hercules, California, USA). Liver mitochondria (0.175 mg/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... Concentration of protein in the eluted fractions was measured using the Bradford method (protein assay dye purchased form Bio-Rad). Fractions containing the proteoliposomes were combined and adjusted to 0.2 mg ml-1 protein concentration ...
-
bioRxiv - Systems Biology 2023Quote: ... and total protein abundance was normalized to 2 μg using the Detergentcompatible Protein Assay (Biorad, Hercules, CA, USA, Cat. # 5000111). 2 μg α-RelA antibody (Cell Signaling ...
-
bioRxiv - Neuroscience 2022Quote: ... in nuclear and cytoplasmic reagents from the kit NE-PER as described by the manufacturer (Thermo Scientific).The cytoplasmic and nuclear supernatants were stored at −80°C until used and lysate protein concentration was determined using the DCTM Protein assay (Biorad).
-
bioRxiv - Neuroscience 2022Quote: ... The supernatants were stored at −80°C until used and lysate protein concentration was determined using the DCTM Protein assay (Biorad).
-
bioRxiv - Neuroscience 2022Quote: ... The supernatants were stored at −80°C until used and lysate protein concentration was determined using the DCTM Protein assay (Biorad).
-
bioRxiv - Neuroscience 2022Quote: ... The supernatants were stored at −80°C until used and lysate protein concentration was determined using the DCTM Protein assay (Biorad).
-
bioRxiv - Neuroscience 2022Quote: ... The supernatants were stored at −80°C until used and lysate protein concentration was determined using the DCTM Protein assay (Biorad).
-
bioRxiv - Neuroscience 2022Quote: ... The supernatants were stored at −80°C until used and lysate protein concentration was determined using the DCTM Protein assay (Biorad).
-
bioRxiv - Cell Biology 2023Quote: ... The cells were spun down and the supernatant was used to measure protein concentration by using a Bradford Assay (BioRad). Equal protein concentrations were loaded onto a NuPAGE 4-12% Bis-Tris gels (Invitrogen) ...
-
bioRxiv - Biochemistry 2023Quote: ... and flash-frozen in liquid nitrogen for storage at −80°C The protein concentration was determined using the DC protein assay (BioRad) per the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The real-time quantitative PCR (qPCR) assays were performed using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad). Amplifications were carried out in a 10 μL final reaction solution containing 12.5ng of cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... Cell number and viability was determined via trypan blue exclusion assays using the Biorad TC20 automated cell counter (Biorad # 1450102). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lysates were diluted 1:10 in RIPA Lysis and Extraction buffer (Thermo Fischer) supplemented with protease inhibitor cocktail (Fischer Scientific) for use in BCA protein assay (BioRad). BCA protein assay was performed in triplicate for each diluted sample following manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... Labeling efficiency was determined by measuring the absorbance of pyrene (χ346nm = 42,000 M-1cm-1) and protein concentration by 660 nm assay (Bio-Rad). An SDS-PAGE shift assay for isolating single-mSA bound ...
-
bioRxiv - Immunology 2023Quote: ... IL-17A titres in human serum samples were quantified using a multiplex cytokine panel (Bio-Plex Pro Human Cytokine Assay, BioRad) and a LuminexCorp Luminex 100 machine as per the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... Protein concentration was used as a reference for the samples and was measured by Bradford protein assay from Bio-Rad.
-
bioRxiv - Biochemistry 2023Quote: ... the total protein concentration was determined by Bradford assay using the Quick Start Bradford 1x Dye reagent (#5000205, Bio-Rad) and BSA (#23209 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lysates were cleared by centrifugation at 14,000 g for 15 min at 4°C and protein concentration was determined using the Bradford assay (Bio-Rad). Sodium dodecyl sulfate (SDS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasma vitamin B12 concentrations were assessed using the BioRad Quantaphase II radio assay (Hercules, CA, USA;74. Plasma folate concentrations were also measured using the BioRad Quantaphase II radio assay (Hercules ...
-
bioRxiv - Cancer Biology 2022Quote: ... The reaction for ddPCR Copy Number Variation Assay was set up in 20 μl sample volume containing 10 μl of 2X ddPCR Supermix (no dUTP, BioRad), 1 μl of FAM-labeled target primers/probe (BioRad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein concentrations of the cellular extracts were determined using the DC Protein Assay (ref 5000112, Bio-Rad, Hercules, California, USA). Equal amounts of proteins (20 μg ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were diluted 50x and the ratio between mitochondrial and nuclear DNA was determined using a custom Taqman based assay and qPCR using a CFX Opus 384 quantitative PCR machine (Biorad). Relative mtDNA abundance was determine using the ΔΔCt method.
-
bioRxiv - Neuroscience 2023Quote: ... Microglia were counted using trypan blue (live-dead assay) on an automated cell counter (TC20 Automated Cell counter, Biorad, 508BR08836).
-
bioRxiv - Cell Biology 2023Quote: ... Protein concentration in the conditioned media and lysates were determined by DC protein assay (Bio-Rad, Hercules CA, 500-011).
-
bioRxiv - Biochemistry 2023Quote: ... The lysates were pelleted at 10,000 g for 10 min and the supernatants were used to determine the protein concentration using Bradford assay (Bio-Rad). After a preclearing step with Protein G Sepharose (Sigma) ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
Effects of menopause and high fat diet on metabolic outcomes in a mouse model of Alzheimer’s diseasebioRxiv - Neuroscience 2023Quote: ... Diabetes-associated markers were assessed using the Bio-Plex Pro Mouse Diabetes 8-Plex Assay (171F7001M; Bio-Rad, Carlsbad, California) according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2023Quote: ... and sample aliquots were diluted 1:50 in water before Bradford protein assay (Bio-Rad, Hercules, CA, USA, Cat# 5000006). Samples were normalized to 1 mg/mL in 0.1% Azo ...
-
bioRxiv - Genetics 2023Quote: ... The supernatant was transferred to a fresh 1.5 ml Eppendorf tube and protein concentration was measured using Bradford assay (Bio-Rad Protein assay Dye reagent Concentrate (#5000006 ...
-
bioRxiv - Cell Biology 2023Quote: ... TAG content was normalized to total protein determined using a standard Bradford Protein assay (Bio-Rad Laboratories, Hercules, CA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... was followed to assay for a unique sequence in IL-12mRNA using the CFX96 Real-Time System (C1000 Thermocycler, BioRad).
-
bioRxiv - Cancer Biology 2023Quote: ... The pellet was resuspended into mitochondrial isolation buffer and for protein concentration test with DC protein assay (Bio-Rad, 5000111). The obtained mitochondria were aliquoted to 1.5 ml Eppendorf tube with 100 ug per tube and centrifuged at 9000 g for 10 min ...
-
bioRxiv - Plant Biology 2023Quote: ... A quantitative real-time PCR (RT-qPCR) assay was performed on a LightCycler 480 II system using 2x SYBR Green qPCR master mix (BioRad). Maize GAPDH (Zm00001eb233140 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cholesterol values were calculated using known cholesterol solutions and normalized to protein content as measured by DC assay (Bio-Rad).
-
bioRxiv - Neuroscience 2024Quote: ... The resulting supernatant was transferred to a clean tube and protein concentration was determined using a Bradford assay (Bio-Rad). 200 μg tissue homogenate or 10 μg cell lysate was diluted in 50 μl CB lysis buffer and was used for the reaction with CatB Substrate (RR-amino-4-trifluoromethyl coumarin (AFC)).
-
bioRxiv - Cell Biology 2024Quote: ... The reaction mixture was prepared using a custom ddPCR assay (#10031276 for FAM and #10031279 for HEX; Bio-Rad Laboratories) and ddPCR Supermix for Probes (no dUTP ...
-
bioRxiv - Plant Biology 2024Quote: ... All RT-qPCR assays were performed on CFX™ Real-Time PCR Detection System (Bio-Rad, Inc., Hercules, CA, USA) instruments equipped with either 96-or 384-well blocks using the following program ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cell extracts were cleared at 5000g for 5min at 4°C and protein concentration was quantified by the Bradford assay (BioRad). Finally ...
-
bioRxiv - Cell Biology 2024Quote: ... The concentration of the protein extracts was quantified using the DC protein assay (Reagent A, #5000113; Reagent B, #5000114; Reagent S, #5000115; BioRad). Finally ...
-
bioRxiv - Neuroscience 2024Quote: ... with total cholesterol levels represented as µg of total cholesterol per mg of protein quantified using Bradford assay (Bio-Rad).
-
bioRxiv - Neuroscience 2024Quote: ... The total protein concentration of each sample was determined using a DC protein assay (Bio-Rad, Hercules, CA; cat #5000111).
-
bioRxiv - Microbiology 2024Quote: Frozen serum samples underwent thawing and preparation in accordance with the specifications outlined in the Bio-Plex Pro Mouse Cytokine 23-Plex assay (BioRad). Subsequently ...
-
bioRxiv - Microbiology 2024Quote: ... The protein concentration of the isolated EVs samples was determined using the Bradford assay with a reactive solution from BioRad, following the instructions provided by the manufacturer ...
-
bioRxiv - Physiology 2024Quote: ... Samples were centrifuged at 14,000g for 15min and the supernatant was collected protein concentration was determined using the DC Protein Assay (Bio-Rad) and transferred to a nitrocellulose membrane ...
-
bioRxiv - Plant Biology 2024Quote: ... and cDNA products were utilized for qRT-PCR assays with SsoFastTM EvaGreen® Supermix (Bio-Rad, Richmond, CA, United States) on a CFX96TM Real-Time PCR detection system (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... The results were normalised to the protein concentration of the homogenates obtained in a Bradford assay (5000006, Bio-Rad, UK).
-
bioRxiv - Neuroscience 2024Quote: ... The resulting tissue lysate was centrifuged at 13,800 g for 15 minutes and the protein concentration was determined using a Bradford assay (Bio-Rad). The protein extracts were then separated by SDS-PAGE on 12% gels and transferred to polyvinylidene difluoride (PVDF ...