Labshake search
Citations for New England Biolabs :
4501 - 4550 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was performed using Luna Universal qPCR Master Mix (New England Biolabs) and quantified on a Bio-rad CFX96 Real-time Detection System (Bio-rad) ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed with Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA) using manufacturer-recommended cycling conditions with a 30 second denaturation cycle to ensure full denaturation of genomic DNA ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was carried out using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA) and the resulting amplicons were incubated with Taq polymerase (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... All PCRs were performed using Phusion Hot Start Flex DNA Polymerase (New England Biolabs) in a 25 μL final reaction volume ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was purified using the Monarch® PCR & DNA Cleanup Kit (NEB, cat# T1030). PCR was performed using either KAPA HIFI 2X ready mix (KAPA Biosystem ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was performed using Taq DNA Polymerase with ThermoPol Buffer (New England Biolabs Ltd) with denaturation at 95° for 3 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR product was inserted into a pBlueScript vector using Gibson assembly (NEB, E2611) and transformed into NEB 5-alpha competent E ...
-
bioRxiv - Microbiology 2023Quote: ... All PCR reactions were performed using Q5 high-fidelity DNA polymerase (NEB, cat. #M0491S) according to the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2023Quote: ... qRT-PCR was completed using the Luna Universal qPCR Master Mix (New England Biolabs). The Elongation Factor 2 homologue (GdEF-2 ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR fragments were joined together using Gibson assembly kit (NEB Cat. No. E2611L) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: SV40 LT area was amplified with PCR using Q5 High-Fidelity DNA Polymerase (NEB). Template was SV40 genome WT4 plasmid which was received as a gift from James DeCaprio ...
-
bioRxiv - Immunology 2023Quote: ... samples were amplified with NEBNext High Fidelity 2x PCR Master Mix (New England Biolabs) (Buenrostro et al ...
-
bioRxiv - Cancer Biology 2024Quote: ... All PCR was performed using Q5 Hot Start High-Fidelity DNA Polymerase (NEB, M0493L) and the Q5 Reaction Buffer Pack (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative PCR (qPCR) was performed using LUNA Universal qPCR Master Mix (New England Biolabs) on the 7500 real-time PCR machine (Applied Biosystems) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The libraries were further amplified by PCR with Pfu polymerase (NEB, Beverly, MA, USA). All libraries were sequenced with the adapter 1 primer using the Illumina HiSeq-2500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by cleaning up with Monarch PCR & DNA Cleanup Kit (T1030, New England Biolabs). The ligated DNA was repaired with PreCR Repair Mix (M0309 ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product obtained were purified using the Monarch DNA Gel Extraction Kit (NEB) and cloned into the pDONR207 using a BP Clonase II Kit (Thermo Fisher) ...
-
bioRxiv - Microbiology 2022Quote: ... Secondary amplification reactions were performed using NEBNext high-fidelity 2 PCR master mix (NEB) in 50 μl reactions (26 μl of 2X mix ...
-
bioRxiv - Biochemistry 2022Quote: All baculovirus constructs were cloned by PCR with Q5 DNA polymerase (New England Biolabs) and Gibson assembly with NEBuilder HiFi DNA Assembly Cloning kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... All PCR reactions were carried out with Q5 High-Fidelity DNA Polymerase (NEB #M0491). The cDNA of Pkd2 was amplified from the plasmid Pkd2-EGFP-N1 (Lab stock ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA polymerase (NEB) and digested using NotI ...
-
bioRxiv - Plant Biology 2022Quote: ... We cloned each fragment into pMiniT using the PCR Cloning Kit (New England BioLabs), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: We performed all PCR cloning with Phusion High-Fidelity DNA Polymerase (New England BioLabs). Total RNA was extracted from 3-5 mm ear primordia of the inbred line B73 using RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Physiology 2022Quote: ... PCR amplification was conducted using Phusion® DNA Polymerase (New England Biolabs, Ipswich, Massachusetts) on cDNA with AmOARβ2 isoform (Table 1) ...
-
bioRxiv - Physiology 2022Quote: ... Reverse Transcription - PCR was performed using Q5 High-Fidelity DNA Polymerase (New England BioLabs), forward primer (ATGCTCGCCAGGATGCTCAACACTACG ...
-
bioRxiv - Cancer Biology 2024Quote: ... CUT&Tag libraries were prepared with NEBNext HiFi 2x PCR Master Mix (NEB M0541S) and indexed primers (Buenrostro et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were purified and cloned using Gibson assembly master mix (New England BioLabs) into LRG3.0 ...
-
bioRxiv - Immunology 2023Quote: ... and amplified using NEBNext® High-Fidelity 2x PCR Master Mix (NEB, Cat. #M0541s) for 9 cycles ...
-
bioRxiv - Biochemistry 2024Quote: All PCR was performed with Q5 High-Fidelity DNA Polymerase kit (New England Biolabs) according to manufacturer’s protocols ...
-
bioRxiv - Biophysics 2024Quote: Cloning procedures involving PCR were performed using Q5 High-fidelity polymerase (New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Cellular genes were amplified by PCR (Q5 High-Fidelity DNA Polymerase, New England Biolabs) after DNA extraction (Quick-DNA Miniprep Kit ...
-
bioRxiv - Microbiology 2024Quote: ... gladioli strain FDAARGOS_389 strain using Q5 High-Fidelity DNA polymerase PCR (New England Biolabs) following 20 µl final volume and reaction components mentioned in the manufacturer’s protocol (https://www.neb.com/en-us/protocols/2013/12/13/pcr-using-q5-high-fidelity-dna-polymerase-m0491) ...
-
bioRxiv - Systems Biology 2024Quote: ... the enzyme’s activity was immediately neutralised using the Monarch PCR & DNA Cleanup Kit (NEB). Subsequently ...
-
bioRxiv - Immunology 2024Quote: ... sample amplification was performed using a library PCR using Q5 Master Mix (M0544L, NEB), 1 µL i7 Index primer (Sigma-Aldrich®) ...
-
bioRxiv - Molecular Biology 2024Quote: qRT-PCR was conducted by using Luna Universal qPCR Master Mix (New Englad Biolabs) and a CFX ConnectTM Real-Time System (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2024Quote: ... and assembled by two-step PCR (supplementary methods) using Q5 polymerase (New England Biolabs). First ...
-
bioRxiv - Molecular Biology 2024Quote: PCR was performed using Q5 High Fidelity 2X Master Mix (New England Biolabs, M0492) with the following temperature and times.
-
bioRxiv - Microbiology 2024Quote: ... The PCR amplifications were performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs) with supplementation with High GC-enhancer to the reaction following the manufacturer’s instructions and primers synthesized by Eurofins Genomics ...
-
bioRxiv - Genomics 2024Quote: The ligation product was purified using a Monarch PCR & DNA Cleanup Kit (NEB #T1030) following the manufacturer’s recommended protocol ...
-
bioRxiv - Developmental Biology 2024Quote: All PCR reactions were done in 50𝜇l volume using Q5 high fidelity polymerase (NEB) following NEB Q5 high fidelity PCR protocol ...
-
bioRxiv - Genomics 2024Quote: ... Two 50 μl PCR reactions were performed per sample with Q5 Polymerase (NEB M0492S) with real-time tracking using SYBR green dye with the following cycling parameters 98°C - 3 min ...
-
bioRxiv - Genomics 2024Quote: ... Four 50 μl PCR reactions were performed per sample with Q5 Polymerase (NEB M0492S) with the following cycling parameters ...
-
bioRxiv - Bioengineering 2024Quote: Constructs were cloned by PCR methods using Q5 High-Fidelity Polymerase (New England Biolabs) and fragments were assembled by Gibson assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR reactions were performed using Q5 High-Fidelity DNA polymerase (New England Biolabs, USA) and purified using DNA Clean and Concentrator 5 kit (Zymo) ...
-
bioRxiv - Bioengineering 2024Quote: ... 500 µL PCR reagents containing 1.67X Q5® High-Fidelity Master Mix (NEB, M0515), 0.625 mg/mL BSA ...
-
bioRxiv - Genetics 2023Quote: ... and introduced mutations using a Q5 Site-Directed PCR Mutagenesis Kit (New England Biolabs). After mutagenesis ...
-
bioRxiv - Immunology 2023Quote: ... the scFv insert from isolated plasmids was amplified by PCR using Q5 polymerase (NEB). DNA samples were prepped and run using the Illumina MiSeq v3 reagent kit following manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2023Quote: PCR amplification was performed using Q5 high fidelity polymerase (New England Biolabs, Hitchin, UK) and PCR screening was performed using GoTaq Flexi DNA polymerase (Promega ...
-
bioRxiv - Microbiology 2023Quote: CloneAmp HiFi PCR Premix (TakaraBio) and Phusion High-Fidelity DNA polymerase (New England BioLabs) were used for PCR reactions for all plasmid constructions ...
-
bioRxiv - Genomics 2022Quote: ... Sequencing adapters were then added with two rounds of PCR with Q5 (NEB #M0492) (GWLP P4-7) ...