Labshake search
Citations for New England Biolabs :
401 - 450 of 5823 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... All libraries were PCR amplified (NEB M0544S) for 5 cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR was performed using Phusion polymerase (NEB). Unique Fluidigm sample barcodes were added using Fast Start High Fidelity PCR System (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... Q5 PCR Master Mix (New England BioLabs) was used for PCR reactions ...
-
bioRxiv - Cell Biology 2023Quote: ... 14-cycle PCR with index primers (NEB) was performed (initial denaturation ...
-
bioRxiv - Microbiology 2023Quote: ... Monarch® PCR & DNA Cleanup Kit (NEB), or Gene Jet gel extraction kit (Thermo Scientific) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR products and NdeI/XhoI (NEB, USA) digested pAN001 vector DNA were assembled using Gibson assembly standard protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Monarch PCR Cleanup Kit (NEB, T1030). PCR primers used ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR with Q5 polymerase from NEB (M0493S), followed by HiFi assembly (NEB E2621S ...
-
bioRxiv - Biochemistry 2023Quote: ... PCR was performed using Phusion polymerase (NEB) and primers that add Illumina adapter sequences and a 6 bp identifier sequence used to distinguish cell populations ...
-
bioRxiv - Cell Biology 2024Quote: ... amplified by PCR (15 cycles, Phusion, NEB) and cloned into the XhoI and EcoRI sites of pSC2 as previously described(38 ...
-
bioRxiv - Systems Biology 2024Quote: ... PCR also introduced specific i5 (NEB, 7780) and N8 (Vazyme ...
-
bioRxiv - Developmental Biology 2024Quote: ... Monarch PCR purification kit (Biolabs, New England) used to purify the resulting amplified cDNA constructs ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR fragment was digested using NotI (NEB) and ligated with NotI-digested pCAG-Puromycin plasmid using T4 DNA ligase (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR amplifications using Q5 polymerase (NEB, M0491S) and restriction digest for ligation or HiFi cloning of fragments (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR was performed with Q5 polymerase (NEB) with 5% DMSO as an additive then amplicons were purified with a PCR cleanup kit (Qiagen) ...
-
bioRxiv - Genomics 2024Quote: ... The OneTaq RT-PCR mix (NEB #E5315) was used to amplify the generated cDNA ...
-
bioRxiv - Physiology 2024Quote: ... TaKaRa)_by PCR amplification (Q5 polymerase, M0491, NEB; forward primer AATGTCGACGCCGCCGCGATCGCCATGA ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR was followed by Quick Ligation (NEB) and transformation by electroporation ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR reactions were digested with DpnI (NEB), and the unmethylated plasmid DNA was used to transform TOP 10 competent E ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA product was PCR amplified (Q5, NEB; 98 °C for 30 s ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR products were treated with Dpn1 (NEB), and linear products were purified via a 1% agarose gel ...
-
bioRxiv - Evolutionary Biology 2020Quote: A solution of 3.0 μl ThermoPol buffer (New England Biolabs), 1 μl dNTPs (10 mM) ...
-
bioRxiv - Genomics 2021Quote: ... 0.5 μL of 1 mg/mLbovine serum albumin solution (NEB), 1.2 μL of 50 mM NAD+ (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... solution and amplified by Phusion High-Fidelity DNA Polymerase (NEB) using primers against the edited locus ...
-
bioRxiv - Genomics 2022Quote: ... 1% bovine serum albumin (BSA) solution (NEB, 20 mg/mL). Nuclei were pelleted at 600 RCF for 5 minutes at 4C ...
-
bioRxiv - Plant Biology 2022Quote: ... The extracted RNA solution was treated with DNAse I (NEB) and then cleaned up with the LiCl method mentioned above.
-
bioRxiv - Genomics 2023Quote: ... TET2 reaction was terminated with 0.3 μL stop solution (NEB) and incubation at 37°C for 30 min ...
-
bioRxiv - Genetics 2024Quote: ... Injection solution contained 300 ng/μL spyCas9 protein (NEB, USA), 100 ng/μL kmo-sgRNA ...
-
bioRxiv - Cell Biology 2020Quote: Resulting amplicons from the second PCR were column purified using Monarch PCR & DNA Cleanup Kit (New England Biolabs; NEB) to remove genomic DNA and first round PCR product ...
-
bioRxiv - Cell Biology 2020Quote: Resulting amplicons from the second PCR were column purified using Monarch PCR & DNA Cleanup Kit (New England Biolabs; NEB) to remove genomic DNA and first round PCR product ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Polymerase chain reaction (PCR) products and plasmids were purified using Monarch® PCR & DNA Cleanup Kit (New England Biolabs) and Sanger sequencing was performed by Eurofins Genomics ...
-
bioRxiv - Molecular Biology 2022Quote: ... The CXCL8 promoter was amplified by PCR with Phusion® High-Fidelity PCR Master Mix with HF Buffer (NEB) according to the manufacturer’s instruction with the following primers:
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR product was purified using Monarch PCR and DNA Cleanup kit (New England Biolabs, Inc., Ipswich, MA, USA) and DNA concentration was quantified using NanoDrop spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... Transposed DNA was PCR amplified using the NEB Next High-Fidelity PCR Master Mix (New England Biolabs, Hitchin, UK) and primer Ad1_noMX in combination with one of six barcoded primers (Table 1 ...
-
bioRxiv - Genomics 2020Quote: Quantification of several genes in sequence libraries was performed by real-time PCR using NEBnext PCR Master Mix (NEB) supplemented with SYBR Green (Applied Biosystems) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We performed a 10-cycle PCR using a Phusion PCR Kit according to the manufacturer’s protocol (New England Biolabs) with multiplexed primers and adjusted PCR products to 10 μM for sequencing on either an Illumina HiSeq2500 (125 bp paired-end ...
-
bioRxiv - Developmental Biology 2021Quote: ... MgCl2 was added to a final concentration of 50mM and 12.2µl of each tagmented sample was PCR amplified for 15 cycles using 2x NEB Next HiFi PCR mix (NEB). Amplified libraries were purified using the Qiagen PCR purification MinElute kit.
-
bioRxiv - Developmental Biology 2021Quote: ... MgCl2 was added to a concentration of 50mM and 16µl of each sample were PCR amplified using 2x NEB Next HiFi PCR mix (NEB) and 16 PCR cycles.
-
bioRxiv - Cancer Biology 2020Quote: ... The promoter region and nanoluciferase coding region was PCR amplified from the pNL1.1 reporter constructs using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB), and 400 nM of forward and reverse primers (pNL1.1_forward 5’-AATTATCTTAAGATTTCTCTGGCCTAACTGGCCGG and pNL1.1_reverse 5’-AATTATCTTAAGTGGGTTGAAGGCTCTCAAGGGCATC) ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real time PCR (qRT-PCR) was performed with the Luna Universal qPCR Master Mix (New England Biolabs #M3003) on a CFX Connect instrument (BioRad #1855200) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real time PCR (qRT-PCR) was performed with the Luna Universal qPCR Master Mix (New England Biolabs #M3003) on a CFX Connect instrument (BioRad #1855200) ...
-
bioRxiv - Microbiology 2020Quote: ... all PCR products were purified using the Monarch® PCR and DNA Clean-up Kit (New England Biolabs, USA) following the manufacturer’s instructions and eluted in molecular grade water.
-
bioRxiv - Zoology 2021Quote: ... The PCR mixtures for first step and nested PCR step (12.5 μl) contained 1X OneTaq Hot Start Master Mix (NEB) and 0.2 μM of each primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative RT-PCR (qRT-PCR) was performed in duplicate with the Luna® Universal qPCR Master Mix (NEB, M3003) using QuantStudio 5 Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Genomics 2020Quote: ... a PCR reaction was run on the diluted sample using 25μL Q5 Hot Start PCR Master Mix (M0494S, NEB) and 2.5μL (20μM ...
-
bioRxiv - Genetics 2022Quote: ... All PCR reactions were conducted using Q5 High-Fidelity 2X PCR Master Mix following the manufacturer’s directions (New England Biolabs). These fragments were transformed into S ...
-
bioRxiv - Microbiology 2021Quote: ... The entire ORF of mucoricin was PCR amplified from cDNA using Phusion High-Fidelity PCR Kit (New England Biolabs) using the primers 5’-GATAAGACTAGTATGTATTTCGAAGAAGGC-3’ and 5’-GGTGATGCACGTGTCCTTCAAATGGCACTA-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: PCR amplifications were carried out using Phusion® High-Fidelity PCR Master Mix with HF Buffer (NEB, Cat#M0531L) according to the manufacturer’s instructions (25 µl reaction) ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial 16S rRNA V4 fragments were PCR amplified using NEBNext Q5 Hot Start HiFi PCR master mix (NEB, U.K.) with universal 16S rRNA V4 primers [564F (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-AYTGGGYDTAAAGNG ...
-
bioRxiv - Genetics 2022Quote: ... PCR reactions were performed using NEBNext® High-Fidelity 2X PCR Master Mix (New England BioLabs, catalog number M0541) following the manufacture’s protocol unless specified differently ...