Labshake search
Citations for New England Biolabs :
451 - 500 of 5823 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs were amplified using a one-step barcoding PCR using NEBNext High Fidelity 2X PCR Master Mix (NEB, M0541L) and the following primers:
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were generated by 7 rounds of PCR amplification using NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplification via PCR was performed using a large-scale PCR system using Q5 polymerase (New England BioLabs, USA) and resulted in 2780 bp linDNA amplicon expression cassettes ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a PCR with 10-13 cycles was performed using the NEBNext High Fidelity 2X PCR Master Mix (NEB) and Ad1_noMX and Ad2.1–2.12 barcoded primers described in (30) ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5S and Saba PCR products were purified using Monarch® PCR & DNA Cleanup Kit (5 μg) (NEB, # T1030). The purified DNA sequence was then analyzed through Sanger sequencing (GENEWIZ from Azenta ...
-
bioRxiv - Molecular Biology 2022Quote: ... the products were amplified by PCR using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs) with 200 nM of Illumina multiplex primer and 200 nM of Illumina index barcode primers (98°C for 10 sec pre-denaturation followed by 12 cycles of 98°C for 5 sec ...
-
bioRxiv - Zoology 2023Quote: ... We performed 5 PCR enrichment with 15 cycles (30 ng DNA input, NEB Phusion High-Fidelity PCR Master Mix) for each library to increase fragment diversity ...
-
bioRxiv - Genomics 2022Quote: ... Purified genomic DNA was directly amplified by 22 cycles of PCR using NEBNext Ultra II Q5 PCR MasterMix (NEB). Sequencing was performed on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... The sequencing libraries were prepared by PCR amplification using the NEBNext PCR master mix (New England Biolabs, no. M0541S). The amplified libraries were purified with AMPure beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were then either purified directly using Monarch PCR and DNA Cleanup Kit (New England Biolabs, Hitchin, UK), or if more than one band was present extracted from 1% TAE gel using the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Addgene cat#52961) by PCR amplification using NEB Next High-Fidelity PCR Master Mix (New England Biolabs, cat#M0541S). The PCR product was digested with Esp3I (BsmBI ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR reactions contained 2 μl cDNA in 50 μl PCR reaction with Phusion Hot Start Flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Genetics 2023Quote: ... The PCR reaction was performed using NEBNext® High-Fidelity 2× PCR Master Mix (New England BioLabs, catalog #M0541) with a reaction volume of 10 ul including 5 ul 2× PCR Master Mix ...
-
bioRxiv - Microbiology 2023Quote: ... The 30 μl PCR reaction system contained 15 μl of Phusion high-fidelity PCR Master Mix (New England Biolabs), 0.2 μM forward and reverse primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... Resulting amplicons from the second PCR were column purified using Monarch PCR & DNA Cleanup Kit (New England Biolabs; NEB) to remove genomic DNA and first round PCR product ...
-
bioRxiv - Cancer Biology 2023Quote: ... Resulting amplicons from the second PCR were column purified using Monarch PCR & DNA Cleanup Kit (New England Biolabs; NEB) to remove genomic DNA and first round PCR product ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... beads were directly used for off-bead PCR amplification using the Phusion High-Fidelity PCR kit (New England Biolabs) for 30 cycles with primers from library amplification (Rd1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and successful PCR products were cleaned up using Monarch® PCR and DNA Clean-Up Kit (New England Biolabs) as per kit instructions ...
-
bioRxiv - Genomics 2023Quote: ... All PCR reactions were performed with 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs), 0.2 μM of forward and reverse primers ...
-
bioRxiv - Cell Biology 2023Quote: The novel entry modules created for this study were cloned by insertion of PCR-amplified sequences in pJet1.3 or pMiniT 2.0 following manufacturer’s instructions (CloneJET PCR Cloning Kit, Thermo Scientific; NEB® PCR Cloning Kit, NEB). BsaI recognition sites followed by module-specific overhangs were added to each primer used to amplify entry sequences ...
-
bioRxiv - Plant Biology 2022Quote: ... were analyzed by Quantitative real time PCR (qRT PCR) using Luna® Universal qPCR Master Mix (New England BioLabs) in a QuantStudio® 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... The target loci were PCR amplified in 30 PCR cycles using Q5 High-Fidelity DNA Polymerase (New England Biolabs), locus-specific primer pairs (Supplementary Information ...
-
bioRxiv - Genomics 2023Quote: ... ATAC-seq libraries were prepared by ∼8 cycles of PCR using NEBNext High Fidelity 2X PCR Master Mix (NEB) and primers containing Illumina barcodes (Buenrostro et al ...
-
bioRxiv - Genomics 2023Quote: ... Accessible DNA libraries were amplified by PCR using NEBNext High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA), custom Nextera PCR primers as previously described (29) ...
-
bioRxiv - Synthetic Biology 2024Quote: All transcription templates were generated using PCR amplification (Phusion High-Fidelity PCR Kit, New England Biolabs, catalog no. E0553) of an oligo that includes a T7 RNAP promoter ...
-
bioRxiv - Genomics 2024Quote: ... The samples were then indexed during PCR amplification during PCR amplification using EM-Seq™ index primers (NEB 7140). The indexed libraries (200 ng each ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA contained in the eluate was then amplified for 14 cycles in 25μl PCR reactions using NEBNext High-Fidelity Q5 2X PCR Master Mix (NEB) and 0.5 mM each of Solexa 1GA and Solexa 1GB primers ...
-
bioRxiv - Microbiology 2024Quote: ... All PCRs were carried out with 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs), 0.2 μM forward and reverse primers ...
-
bioRxiv - Genomics 2024Quote: ... cDNA was PCR amplified using the NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs, Cat. No. M0541) with the following forward and reverse primers ...
-
bioRxiv - Genomics 2024Quote: ... Tagmented DNA was PCR amplified using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs, Cat. No. M0541) with indexed primers (CAAGCAGAAGACGGCATACGAGATNNNNNNNNNNGTCTCGTGGGCTCGG and AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Genomics 2024Quote: ... ATAC-seq libraries were then PCR amplified using NEBNext High-Fidelity PCR master mix (New England Biolabs, Ipswich, US) and index primers from Nextera Kit (Illumina) ...
-
bioRxiv - Genetics 2024Quote: ... The PCR fragments were purified using Monarch® PCR & DNA Cleanup Kit (5 μg) from New England Biolabs (NEB) Cat#T1030L ...
-
bioRxiv - Cancer Biology 2024Quote: ... One hundred ng of DNA template was used to generate PCR using Phusion® High-Fidelity PCR kit (NEB). PCR was performed by using DNA Engine Tetrad® Thermal cycler (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... Vector and insert fragments were linearized by PCR using Phusion High-Fidelity PCR Master Mix with HF (NEB #M0531S), and template DNA was digested with DpnI (NEB #R0176S) ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction (PCR) was performed on a genomic rat DNA template using a Taq PCR Kit (New England Biolabs), and the subsequent PCR product was purified using a Qiagen PCR Purification Kit (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA library yield was increased by a further round of PCR with Post LM-PCR oligos (Nimblegen) and Q5 High-Fidelity DNA polymerase (NEB). The PCR reaction consisted of 30 μl of the mono or di nucleosomal DNA libraries (150270 ng) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were amplified for 12 PCR cycles with unique dual index primers using the NEBNext Hi-Fi 2X PCR Master Mix (New England Biolabs). Amplified libraries were purified using a 1.2X ratio of Axygen magnetic beads (Corning Inc ...
-
bioRxiv - Microbiology 2022Quote: ... and amplicons were generated by PCR (primers 341F and 806R) using a Phusion High-Fidelity PCR Master Mix (New England Biolabs). Amplification product quality was assessed by gel electrophoreses and samples were pooled in equimolar ratios ...
-
bioRxiv - Genomics 2020Quote: ... 2.5uL reverse PCR primer (CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT) and 25uL NEBnext High-Fidelity 2x PCR Master Mix (New England Biolabs, MA, United States)) using thermo-cycler conditions described in 94 for a total of 9 cycles ...
-
bioRxiv - Immunology 2020Quote: ... The whole resulting product was then PCR-amplified using indexed primers with NEBNext High-Fidelity 2X PCR Master Mix (NEB). First ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification was performed in 1X Phusion® High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs M0531) and PCR cycling at 98°C for 30s ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were amplified by PCR using NextFlex PCR primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) before three further rounds of AMPure XP purification were performed to collect fragments 150-300 bp in size ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Genetic parts were amplified using primers listed in Table S1 and PCR products were purified with the Monarch PCR & DNA Clean up kit (NEB). Parts were assembled into plasmid constructs mainly by Gibson assembly [41] using the isothermal method ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification was performed in 20 uL 1X Phusion® High-Fidelity PCR Master Mix with HF Buffer (NEB M0531) and using touchdown PCR cycling at 98°C for 30s ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analyses were performed using Luna Universal Probe One-Step qRT-PCR Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR products were gel-purified and used for a second round of PCR amplification (Q5 NEB master mix, 7 cycles) using custom primers to attach Illumina read sequences ...
-
bioRxiv - Microbiology 2020Quote: ... these long gene sequences containing enzyme sites firstly was amplified by common PCR by Q5 high-fidelity PCR kit (Cat: #M0491, NEB), using primer F and R pairs of S or N ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tagmented DNA was amplified with 12 cycles of PCR using the NEBNext Hi-Fi 2X PCR Master Mix (NEB M0541) and unique dual index primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then amplified by PCR using custom nextera primers at 400 nM and NEBNext HiFi 2x PCR Master Mix (New England Biolabs) (Buenrostro et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The ORF was removed by inverse PCR to generate the genomic deletion vector (P5/P6) and plasmid recircularized from PCR product (KLD enzyme blend, NEB).