Labshake search
Citations for New England Biolabs :
551 - 600 of 5823 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 µg of purified DNA (PCR product after 2nd round PCR after selections) was incubated with PstI-HF (New England Biolabs) at 37 °C for 1 h ...
-
bioRxiv - Bioengineering 2023Quote: ... genomic loci were amplified in a first PCR reaction (PCR-1) reaction from approximately 100 ng of gDNA using Q5 High-fidelity DNA Polymerase (NEB) and the primers listed in Sup ...
-
bioRxiv - Neuroscience 2023Quote: Quantitative real-time PCR (qRT-PCR) was used to measure RNA with Luna Universal One-Step RT-qPCR Kit (New England Biolabs) via CFX Connect Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2024Quote: ... The first-strand cDNA was then amplified in a PCR reaction with Phusion High Fidelity PCR Master Mix (New England Biolabs) using BRBV segment-specific primers targeting the segment termini ...
-
bioRxiv - Immunology 2024Quote: ... sgRNA guide sequences were recovered as amplicons generated by PCR of the genomic DNA using Phusion High-Fidelity PCR Master Mix with GC Buffer (M0531L, NEB) with forward (TCTTGTGGAAAGGACGAGGTACCG ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR products from divergent primers of expected length were excised and purified via PCR clean up kit (New England Biolabs) for confirmation of BSJ using Sanger Sequencing.
-
bioRxiv - Microbiology 2024Quote: ... according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB). Library molarity was measured with the Qubit DNAds HS assay kit from Invitrogen and the quality was analyzed using Bioanalyzer DNA Analysis kit (Agilent ...
-
bioRxiv - Microbiology 2024Quote: ... The amplification product of pan-CoV semi-nested PCR was purified and concentrated by the Monarch PCR & DNA Cleanup Kit (NEB), according to the protocol supplied ...
-
bioRxiv - Microbiology 2024Quote: ... 1μg template for the first PCR and 40ng for the second PCR was amplified using NEBNext master mix (NEB, M0541) and cleaned using SPRI beads (BECKMAN COULTER) ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were assembled from restriction enzyme-linearized or PCR-amplified vector and PCR products or synthetic DNA fragments using the NEBuilder Hifi DNA assembly kit (E2621; NEB). Plasmids were transformed into electrocompetent E ...
-
bioRxiv - Genomics 2024Quote: ... To generate libraries 50uL PCR reactions were made using 25uL NEBNext® High-Fidelity 2X PCR Master Mix(NEB #M0541L), 2.5uL of universal Ad1_noMx primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL reactions were prepared for the second PCR by mixing 25 µL of 2× Phusion High-Fidelity PCR Master Mix (New England Biolabs), 15 µL of cleaned-up PCR product from the first PCR and 10 µL Nextera DNA CD Indexes (96-well format from Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR reactions were 50 µL final with 200 nM forward and reverse primers with 1x Q5 PCR Master Mix (NEB); 23 cycles of 98°C for 20 seconds ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA contained in the eluate was then amplified for 12-14 cycles in 25 μL PCR reactions using NEBNext High-Fidelity Q5 2X PCR Master Mix (NEB) and 0.5 mM each of primers Solexa 1GA and Solexa 1GB ...
-
bioRxiv - Bioengineering 2024Quote: ... overlapping fragments were amplified by PCR and the PCR products and the digested plasmid were assembled using Gibson Assembly kit (New England Biolabs) to obtain the resulting plasmid.
-
bioRxiv - Developmental Biology 2024Quote: ... Single worm PCR was performed by picking individual worms into PCR tubes containing 1X Taq reaction buffer (NEB, Cat#B9014S), Proteinase K (Roche ...
-
bioRxiv - Genetics 2024Quote: ... 128 μL of sample was amplified in 400 μL polymerase chain reactions (PCRs) across 8 PCR tubes using Q5 High-Fidelity DNA Polymerase (NEB). Primers contained partial Illumina adapters ...
-
bioRxiv - Cancer Biology 2021Quote: ... Universal PCR primers and Index (X) Primer (NEB). PCR products were then purified (AMPure XP system ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR fragments were amplified using Q5 polymerase (NEB). Vectors were digested using enzymatic restriction digest and ligated to gel purified PCR products using Gibson assembly ...
-
bioRxiv - Cell Biology 2020Quote: All PCR was conducted using Phusion polymerase (NEB) using primers listed in Supplemental Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR products were cut by BfaI (R0568S, NEB) in case of LRP5 KO and Hpy188III (R0622S ...
-
bioRxiv - Genetics 2021Quote: ... PCR was done using Q5 polymerase (M0492S, NEB). Primers used to detect the presence of amx cDNA were 5’-TCCCCGCTCTATCTGACCAA-3’ and 5’- GCTCTGTTGCCACATTTCCG-3’ ...
-
bioRxiv - Genetics 2020Quote: ... a large scale Phusion PCR (NEB, Ipswich, USA) was performed using a forward (5’-GAATTGTCTCGTTCGCAAATAC-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplifications were performed with Q5 polymerase (NEB). All other necessary enzymes were also purchased from NEB ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... six parallel PCR reactions (Q5 DNA polymerase, NEB) were set up with 30 µl of sample ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR using Q5 DNA polymerase (New England Biolabs) instead of KAPA HiFi ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR fragments were amplified using Q5 polymerase (NEB). Vectors were digested using enzymatic restriction digest and ligated to gel purified PCR products using Gibson assembly ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR products were subsequently digested with AarI (NEB), and ligated to barcodes consisting of phosphorylated ...
-
bioRxiv - Genetics 2020Quote: ... and purified using a PCR purification kit (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... PCR product was ligated using T4 ligase (NEB) and amplified using outer primers to produce the fusion gene S1R-APEX2 ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR master mixes (NEBNext High fidelity, M0541S, NEB) containing unique barcoding primers per well were dispensed on top of the reverse crosslinking buffer and DNA was amplified with the following cycling conditions ...
-
bioRxiv - Bioengineering 2021Quote: ... were amplified by PCR using Phusion Polymerase (NEB). The amplicons and the linearized plasmid were assembled using an NEBuilder HiFi DNA assembly kit (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR products were ligated with T4 ligase (NEB). The resulting plasmid (pRG85_CM ...
-
bioRxiv - Biophysics 2020Quote: ... we PCR amplified a Lambda DNA fragment (NEB) of ~50% GC-content with the oligonucleotides 114.F RNA control 612 and 113.R RNA control 1316 ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were subsequently digested with Dpnl (NEB) to eliminate residual plasmid sequence and purified with QIAquick PCR Purification columns (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR with Phusion High Fidelity DNA Polymerase (NEB) or iProof DNA Polymerase (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out using Q5 polymerase (NEB) with genomic DNA as template from their respective mutant in MKP103 background [91] and primers listed in Table S3 ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR product was ligated into NruI (NEB) digested pEAQ-HT Nicotiana benthamiana overexpression vector (Sainsbury et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR products were phosphorylated with polynucleotide kinase (NEB) and circularized with T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... PCR reaction and a KLD enzyme mix (NEB). The resulting plasmids were transformed into chemically competent DH5α cells and sequences were confirmed by Sanger double stranded DNA sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Standard PCRs were run using Taq Polymerase (NEB) using primers provided in Supplemental Table 3 ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry was PCR amplified with Q5 polymerase (NEB) using primers JM403 (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTACAATGAAAGCCTTCACACTCGCTCTC TTCTTAGCTCTTTCCCTCTATCTCCTGCCCAATCCAGCCATGGTGAGCAAGGGCGA GGAGG-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-PCR with OneTaq (New England Biolabs #M0480S) was performed on cDNA preparations ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were treated with DpnI (NEB) at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... barcode PCR amplification using Q5 DNA polymerase (NEB) and Illumina adaptor-encoded primers that include unique 6-bp TruSeq indexes in the forward primer ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR amplified (Phusion DNA polymerase; New England Biolabs) and cloned into the NheI and NcoI restriction site of the AAV-EF1a-DIO-EYFP vector ...
-
bioRxiv - Biochemistry 2021Quote: ... and a Monarch PCR & DNA Cleanup kit (NEB) with the following changes ...
-
bioRxiv - Microbiology 2020Quote: ... and then PCR amplified for 20 cycles (NEB Phusion Master Mix ...
-
bioRxiv - Microbiology 2021Quote: ... all PCR reactions were performed using Phusion (NEB) with primers to add a 5’ Eco52I restriction site and a 3’ KpnI restriction site (see Supp Table 3 for oligos) ...