Labshake search
Citations for New England Biolabs :
601 - 650 of 5823 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... PCR reaction and a KLD enzyme mix (NEB). The resulting plasmids were transformed into chemically competent DH5α cells and sequences were confirmed by Sanger double stranded DNA sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Standard PCRs were run using Taq Polymerase (NEB) using primers provided in Supplemental Table 3 ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry was PCR amplified with Q5 polymerase (NEB) using primers JM403 (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTACAATGAAAGCCTTCACACTCGCTCTC TTCTTAGCTCTTTCCCTCTATCTCCTGCCCAATCCAGCCATGGTGAGCAAGGGCGA GGAGG-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-PCR with OneTaq (New England Biolabs #M0480S) was performed on cDNA preparations ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were treated with DpnI (NEB) at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... barcode PCR amplification using Q5 DNA polymerase (NEB) and Illumina adaptor-encoded primers that include unique 6-bp TruSeq indexes in the forward primer ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR amplified (Phusion DNA polymerase; New England Biolabs) and cloned into the NheI and NcoI restriction site of the AAV-EF1a-DIO-EYFP vector ...
-
bioRxiv - Biochemistry 2021Quote: ... and a Monarch PCR & DNA Cleanup kit (NEB) with the following changes ...
-
bioRxiv - Microbiology 2020Quote: ... and then PCR amplified for 20 cycles (NEB Phusion Master Mix ...
-
bioRxiv - Microbiology 2021Quote: ... all PCR reactions were performed using Phusion (NEB) with primers to add a 5’ Eco52I restriction site and a 3’ KpnI restriction site (see Supp Table 3 for oligos) ...
-
bioRxiv - Neuroscience 2022Quote: ... The PCR products were digested using DpnI (NEB) at 37°C for 90 minutes and then transformed into DH5α chemically competent cells ...
-
bioRxiv - Genomics 2020Quote: ... PCR fragments were treated with Nb.BbvCI nickase (NEB) before purification and ligating the Y-shape with the correct overhang ...
-
bioRxiv - Molecular Biology 2020Quote: ... and PCR-amplified using the Phusion polymerase (NEB) and specifics primers flanking exon 6 of the STAU1 gene (sense ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification was done with Q5 polymerase (NEB) performed on a LightCycler 96 System (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... We used the Phusion PCR polymerase mix (NEB) containing 25 pmol each of the following two oligo sequences ...
-
bioRxiv - Genomics 2020Quote: ... PCR was performed with Phusion DNA polymerase (NEB) and we used a slow ramp for the elongation step from 72°C to 98°C to allow the synthesis of the loop on the reverse primer ...
-
bioRxiv - Microbiology 2020Quote: ... PCRs were performed with Q5 (New England Biolabs) and KOD (Novagen ...
-
bioRxiv - Microbiology 2020Quote: All PCR was conducted using Phusion polymerase (NEB) using primers listed in Supplemental Dataset 2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR product was digested with DnpI (Biolabs) for 5hr and transfected into E ...
-
bioRxiv - Biophysics 2020Quote: ... The PCR products were then phosphorylated (NEB M0201S) and ligated (NEB M0202S ...
-
bioRxiv - Genetics 2020Quote: ... PCR amplification was performed with LongAmp Polymerase (NEB) or PrimerStar GXL (Takara) ...
-
bioRxiv - Biophysics 2021Quote: ... amplified by PCR (Q5-Hot Start Polymerase, NEB) using oligos oGJJ078-79 to add a HindIII and NheI restriction sites ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was carried out using Q5 polymerase (NEB) with AZ101 genomic DNA as template ...
-
bioRxiv - Immunology 2021Quote: ... PCR was performed using Phusion DNA polymerase (NEB) and corresponding primers (Table I) ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was performed using Q5 DNA polymerase (NEB). A 227 bp fragment of the mitochondrial ATPase subunit-1 gene was amplified from the bisulfite converted and non-converted DNA samples using the degenerate ATP1.1-F and ATP1.1-R primer pair described previously36 ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reactions were performed with Q5 polymerase (NEB) unless specified otherwise ...
-
bioRxiv - Molecular Biology 2023Quote: ... fragments were PCR amplified using Q5 polymerase (NEB) and vectors were digested using restriction enzymes ...
-
bioRxiv - Genetics 2023Quote: PCR was performed using OneTaq polymerase (NEB #M0480). Reactions consisted of 1X OneTaq Standard Reaction Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was digested with BamHI (NEB), and the resulting 514 bp fragment was gel purified from a 1.5% Agarose gel using the GeneJet Gel Extraction Kit (Thermo Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR was performed using Taq (New England Biolabs) or Phusion (Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: PCR was performed using OneTaq polymerase (NEB #M0480). Reactions consisted of 1X OneTaq Standard Reaction Buffer ...
-
bioRxiv - Biophysics 2023Quote: ... PCR was performed using Q5 DNA Polymerase (NEB) followed by purification using DNA clean and concentrator spin-column purification (Zymo) ...
-
bioRxiv - Cell Biology 2023Quote: ... using Luna PCR Master Mix (New England Biolabs). Fold induction was calculated by comparing relative gene expression to the housekeeping gene 18S RNA using the ΔΔCT method64.
-
bioRxiv - Immunology 2023Quote: ... and PCR product was digested with DpnI (NEB) and in some cases ligated with T4 DNA ligase (NEB) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the PCR products were digested (NEB restriction enzymes) and cloned directionally into plasmid pBIN61 ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were obtained using Q5 Polymerase (NEB) or Expand Long Template PCR system (Roche/Sigma ...
-
bioRxiv - Genomics 2023Quote: ... using the Phusion High Fidelity PCR kit (NEB) using primers designed to span the ATAC-seq signals (Table S7 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mrj was PCR amplified using Q5 polymerase (NEB) using TopoD-Entr-Mrj clone as a template ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were subsequently digested by DpnI (NEB) and transformed into DH5α E ...
-
bioRxiv - Molecular Biology 2022Quote: ... and PCR was performed using Q5 polymerase (NEB). Heterozygous enhancer deletions were generated to facilitate allele-specific SOX9 gene expression analysis.
-
bioRxiv - Developmental Biology 2024Quote: ... PCR reactions with Q5 high fidelity polymerase (NEB) were carried out as follows ...
-
bioRxiv - Bioengineering 2024Quote: ... and a Monarch PCR & DNA Cleanup kit (NEB) with the following changes ...
-
bioRxiv - Genetics 2023Quote: ... PCR amplified with Q5 polymerase (New England Biolabs) and incubated with restriction enzyme-digested CD510-B1 plasmid (SystemBio ...
-
bioRxiv - Biochemistry 2024Quote: ... The PCR reaction was DpnI (New England Biolabs) digested at 37 °C for 2 h without prior clean-ups ...
-
bioRxiv - Microbiology 2024Quote: ... high-fidelity PCR reactions (NEB Q5 DNA Polymerase) with pBSV2G and pcon++flgV were performed using primers PA470 + PA467 and PA466 + PA467 ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR using Q5 High-Fidelity DNA polymerase (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR products were digested with Hpy166II (R0616S, NEB).
-
bioRxiv - Evolutionary Biology 2024Quote: ... amplified by PCR with Phusion DNA polymerase (NEB) with RBNS index primers and RBNS reverse primer I (see below) ...
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were amplified using -inverse PCR (Q5, NEB), using primers with overhangs containing spacer sequences ...
-
bioRxiv - Microbiology 2024Quote: Colony PCR was performed using either Q5 (NEB) or Sapphire master mix (Fisher Scientific ...