Labshake search
Citations for New England Biolabs :
3951 - 4000 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... The first round was performed with primer pairs listed in Supplementary Table S7 with 16 cycles using NEBNext High Fidelity Master Mix (NEB, # M0541) for the screens with EpiC and Tiling libraries and NEBNext Ultra II Q5 Master Mix (NEB ...
-
bioRxiv - Systems Biology 2023Quote: We amplified the synthesized oligo library using the following primer pair GGCTTTATATATCTTGTGGAAAGGACGAAACACCG (Forward) and CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (Reverse) with NEBNext High-Fidelity Master Mix (NEB, #M0531) for 10 cycles ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR amplification of DNA fragments was performed using high-fidelity polymerases: Q5 DNA Polymerase (New England Biolabs, Frankfurt am Main, Germany), Phusion Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: Plasmid construction was performed by: PCR amplification of the fragment to insert in the plasmid with Q5® High-Fidelity DNA Polymerase (New England Biolabs), digestion with the appropriate FastDigest restriction enzymes (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... A range of cycle numbers was used to amplify the small RNA amplicons using Q5 High-Fidelity DNA polymerase (NEB M0491L). Amplified cDNA samples were loaded on 10% polyacrylamide gel (Bio-Rad 3450051) ...
-
bioRxiv - Cancer Biology 2023Quote: ... NGS sequencing libraries were prepared from 1 µg of genomic DNA spiked with known ‘spike-in’ controls by introducing Illumina adaptors and 5-bp-long index sequences using Q5® High-Fidelity 2X Master Mix (NEB). The barcode amplification was verified in parallel polymerase chain reaction (PCR ...
-
bioRxiv - Genetics 2023Quote: Library oligos for the prime editing screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB M0541L) with the forward primer GTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT and the reverse primer CTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGGTGTTAGG ...
-
bioRxiv - Plant Biology 2023Quote: ... a 2.7 kb genomic fragment corresponding to the MIR319C URR from the start of pre-MIR319C was amplified from Col-0 genomic DNA using Phusion High Fidelity DNA polymerase (M0530, New England Biolabs, USA) and cloned into P4P1R to generate the pMIR319C-P4P1R construct ...
-
bioRxiv - Cell Biology 2023Quote: ... and the integrated sgRNA library was amplified from the genomic DNA by PCR using Q5 Hot Start High-Fidelity 2x Master Mix (NEB #M0494L) and oligos ol3 and ol4 (Supplementary Table 1) ...
-
bioRxiv - Genomics 2023Quote: ... thirty 20 μl ePCRs were performed using 400 ng of DNA for each reaction and NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S) with the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmid CassetteAv2_pBAD contains the CRISPR03 array cloned into the pBAD/Myc–His B backbone (Life Technologies).12 It was used to prepare CRISPR DNA substrates by PCR with primers MMB1Lead40-5 and MMB1crisp3-r1 using Phusion High-Fidelity DNA polymerase according to the manufacturer’s protocol (New England Biolabs or ThermoFisher). The resulting 88-bp PCR product has a 40-bp leader ...
-
bioRxiv - Genomics 2023Quote: ... were synthesized to amplify the genome-edited region of the corresponding genes using Phusion high-fidelity DNA Polymerase (New England Biolabs, M0530L). For each PCR reaction of 50 μl volume ...
-
bioRxiv - Molecular Biology 2023Quote: ... A minimum of 6 PCR reactions were set up per sample and 200 ng of genomic DNA was used per reaction using NEB Q5 Hot Start High-Fidelity master mix (NEB M0494) with PCR1 conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCRs were conducted in volumes of 30 μL comprising a Phusion® High-Fidelity PCR Master Mix (New England Biolabs) (15 μL) ...
-
bioRxiv - Systems Biology 2023Quote: ... RNA is subsequently ligated with an “RNA Phosphate Modified” (RPM) adaptor (Quinodoz et al 2021) using High ConcentrationT4 RNA Ligase I (NEB, M0437M). Beads were incubated at 24°C for 1 hour 15 minutes with shaking at 1400 rpm ...
-
bioRxiv - Cell Biology 2022Quote: ... The mutant fragments were amplified by high-fidelity DNA polymerase 2 × Phanta Max Master Mix followed by DpnI (New England BioLabs; R0176S) digestion in 37°C for 1 hour to eliminate the templates ...
-
bioRxiv - Cancer Biology 2023Quote: ... genomic DNA was isolated from bulk tumor-bearing lung tissue followed by PCR amplification of the sgID-BC region from 32 μg of bulk lung genomic DNA using Q5 Ultra II High-Fidelity 2x Master Mix (New England Biolabs, M0494X). Unique dual-indexed primers were used to amplify each sample followed by purification using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genetics 2022Quote: ... locus using the primers ubb polyA fw: 5’-TAGAACCGACAGTCTTAGGGATGG-3’ and ubb polyA rv: 5’-GAATTCATTGCCATCAAGTGTTAGC-3’ with Phusion High Fidelity DNA Polymerase (NEB M0530S), subcloned into the Zero Blunt TOPO PCR Cloning vector (Invitrogen K283020) ...
-
bioRxiv - Genetics 2023Quote: ... Knockout of the genes was confirmed by running PCR reactions using Q5® High-Fidelity DNA Polymerase (NEB, cat no. M0491) and the following primers on a 2.5% agarose gel:
-
bioRxiv - Developmental Biology 2023Quote: ... Eluted fragments were amplified by PCR with an appropriate number of PCR-cycles (5-8) using Custom NExtera PCR primers50 and the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S). Amplified DNA was purified using Qiagen MinElute Kit (Qiagen ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... RT-PCR or qPCR was performed with 1 μl of 1:2 diluted cDNA using the Q5®Hot Start High-Fidelity 2X Master Mix (NEB) or the SYBR™ Green PCR Master Mix (ThermoFisher) ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: Purified DNA was amplified with human-or mouse-specific primers covering the RBM20 RS-domain mutation hotspot with Nextera-compatible adapters (Sup. Table 1) using Q5®Hot Start High-Fidelity 2X Master Mix (NEB). One microliter of a 1:100 dilution was used for a second PCR attaching sample-specific index barcodes (Nextera XT Index Kit v2 Set A ...
-
bioRxiv - Cell Biology 2023Quote: ... Full-length and mutants (E1235V and D1196N) were generated by site-directed mutagenesis using the Phusion High-Fidelity DNA Polymerase (New England Biolabs, #M0530S), followed by DpnI digestion (Takara ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR reaction volume used was 50 μl: 0.2 μl of Q5® high-fidelity DNA polymerase (New England Biolabs, UK), 10 μl of Q5® reaction buffer (5X ...
-
bioRxiv - Plant Biology 2023Quote: ... and PEP444c were amplified using a cDNA template obtained from 2-week-old barley shoots and roots and Q5® High-Fidelity DNA Polymerase (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... The PfTrxBamA/ECL4 Mexico A construct was generated by reverse PCR using Q5 Hot Start High-Fidelity DNA polymerase (New England Biolabs, Inc.) in a 25 μl reaction containing 100 ng of PfTrxBamA/ECL4 (Nichols ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All Streptomyces colony PCRs were performed using Q5® High-Fidelity DNA Polymerase with GC Enhancer (New England BioLabs Inc., U.S.A).
-
bioRxiv - Cell Biology 2023Quote: ... full-length CTPS1 and CTPS2 cDNAs were obtained by PCR as previously described [26] using the Q5® High-Fidelity DNA Polymerase (New England Biolabs). For CTPS1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by PCR amplification of the gRNA cassette using primers compatible with Illumina sequencing and NEB Q5 Hot Start High-Fidelity master mix (NEB M0494) (see primers listed in Supplemental Table 1) ...
-
bioRxiv - Genomics 2023Quote: Library oligos for the MYC enhancer screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), forward primer ...
-
bioRxiv - Developmental Biology 2023Quote: Off-target predictions were carried out using CRISPOR81 he top ten off predicted off-target sites for the Patient 1-Corrected and RASGAP dead iPSC lines amenable to PCR were amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs; M0491S) and the resulting PCR products underwent Sanger Sequencing ...
-
bioRxiv - Developmental Biology 2023Quote: Human and bovine XIST E repeats were PCR amplified from cDNA generated from either total RNA of Ishikawa (human) or bovine stromal cells (Supplementary Table S4) with the Q5 High-Fidelity DNA polymerase (NEB, UK) or the non-proofreading Taq DNA Polymerase (EP040 ...
-
bioRxiv - Microbiology 2023Quote: ... or treated with 0.1 mM carbonic anhydrase inhibitor – S4 for 24 h was subjected to semi-quantitative RT-PCR analyses using Q5 high-fidelity DNA polymerase (New England Biolabs Inc.) according to manufacturer’s protocol in a T100 Thermal cycler (BIO-RAD) ...
-
bioRxiv - Neuroscience 2023Quote: ... as wildtype or T205A variant were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity master mix (M0492, New England Biolabs (NEB)) from previous plasmid constructs 16 ...
-
bioRxiv - Molecular Biology 2023Quote: ... ATAC-seq libraries were then prepared using Custom Nextera PCR primers and NEBNext High-Fidelity 2x PCR Master Mix (NEB, #M0541).
-
bioRxiv - Genetics 2023Quote: ... we split clean genomic DNA into PCR replicates (each containing gDNA from approximately 250,000-500,000 cells) and amplified the genomic region of interest with Q5 High-Fidelity 2X Master Mix (New England Biolabs, no M0492L) and 0.5 uM of each amplification primer (Supplementary Table 11) ...
-
bioRxiv - Genetics 2023Quote: ... n=16 ligations were performed using 300 ng of digested and dephosphorylated Trono-BR backbone and 3 ng of digested insert with high concentration T4 DNA Ligase (NEB #M0202M). The ligation reactions were precipitated using QuantaBio 5PRIME Phase Lock Gel tubes before being resuspended in 3 µL of EB Buffer per 4 precipitated reactions ...
-
bioRxiv - Microbiology 2023Quote: ... 1990) tagged with Illumina adapters in PCR reactions using a Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs). The 25 amplification cycles were as follows ...
-
bioRxiv - Microbiology 2023Quote: ... Amplification of target genes was carried out using a SYBR Green based qPCR mix consisting of Q5® High-Fidelity 2× Master Mix (NEB), SYBR Green ...
-
bioRxiv - Genomics 2023Quote: The open reading frames encoding distinct rBE candidates were amplified using Q5 High- Fidelity DNA Polymerase (New England Biolabs, Cat # M0491). The PCR primers were designed to produce PCR product flanked by ∼ 40 bp of sequence complementary to the target backbone vector ...
-
bioRxiv - Genomics 2023Quote: The purified cDNA was PCR amplified for 6 cycles to generate dsDNA with NEBNext Ultra II Q5 High-Fidelity 2X Master Mix (NEB, M0544) and 0.5 uM PCR primers with unique dual index using the following PCR cycles:
-
bioRxiv - Cancer Biology 2023Quote: ... Transposed DNA was then purified on Diapure columns (Diagenode, Transposed purified DNA was then pre-amplified for 5 PCR Cycles using NEBNext High-Fidelity PCR MasterMix (NEB, M0541) and Illumina indexing primers ...
-
bioRxiv - Cell Biology 2023Quote: ... The ADT-derived cDNAs contained in the supernatant were further purified (see SI Appendix) and used as template in a PCR reaction with the NEBNext® High Fidelity Master Mix (NEB), a Truseq small RNA RPIx (containing i7 index ...
-
bioRxiv - Cell Biology 2023Quote: ... The C-terminal truncation of murine STING (to include only amino acids 1-339) was accomplished using NEB Q5 High-Fidelity 2X Master Mix (NEB M0492S) per the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the targeted DNA region was amplified by PCR using the biomass as the template with the Q5™ High-Fidelity 2× master mix (New England Biolabs). Base-editing efficiency when targeting a plasmid-borne gene was estimated by isolating plasmid DNA upon 24-h editing treatment by using the NucleoSpin™ plasmid EasyPure kit (Macherey-Nagel ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Linear DNA constructs encoding Dam or eGFP were amplified via PCR from the plasmids pJV302 (Dam) and pJV170 (eGFP) using NEB’s Q5 HotStart High-Fidelity 2x Master Mix (NEB CN# M0494S). PCR reactions were treated with 1 μL of DPNI for 3 h at 37°C and purified with Zymo Research’s Clean & Concentrator-5 kit according to the manufacturer’s protocol (Zymo CN# D4004).
-
bioRxiv - Cancer Biology 2024Quote: ... Ligation of sequences was performed by PCR-based cloning via addition of specific restriction sites using the Phusion High-Fidelity PCR Master Mix (New England Biolabs, #F531L), restriction digest and subsequent ligation using T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... Shipston and was N-terminally attached to an RFP (BKCa-DECRFP) using KpnI and BamHI restriction sites after PCR amplification (NEB Q5 High-Fidelity DNA-Polymerase, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Biophysics 2024Quote: ... PCR was performed according to manufacturer’s instructions for the Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs, USA). After 30 s at 98 ℃ for initial denaturation ...
-
bioRxiv - Plant Biology 2024Quote: ... 260 to 300bp mRNA (CDS or UTR) sequences of enzymes were amplified by PCR using Q5® High-Fidelity DNA Polymerase (New England Biolabs) with primers listed in Supplementary Table S6and cut by BamHI and SalI (New England Biolabs) ...