Labshake search
Citations for New England Biolabs :
3851 - 3900 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... TE buffer (20 µL) was added and PCR was performed using NEBNext High-Fidelity 2X PCR Master mix (New England Biolabs, M0541) as follows ...
-
bioRxiv - Systems Biology 2022Quote: ... The Ni-elution was collected directly on a pre-equilibrated amylose column (amylose high flow resin, New England Biolabs, Ipswich, Massachusetts). Amylose column was washed with 5 column volume cold wash buffer before fractionated elution in a buffer containing 25 mM Hepes pH 7.5 ...
-
bioRxiv - Bioengineering 2022Quote: ... Genes encoding individual components of biosensors were amplified by polymerase chain reaction (PCR) using Q5® High-Fidelity DNA Polymerase (New England Biolabs). Site-directed mutagenesis was performed by QuikChange lightning mutagenesis kit (Agilent ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tagmented DNA was PCR amplified using custom i5 and i7 PCR primers and Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB). PCR conditions were ...
-
bioRxiv - Synthetic Biology 2019Quote: ... PCR amplification of DNA for cloning purposes was performed using the Q5 High-Fidelity Polymerase (New England Biolabs, Ipswich, MA, USA). All primers and plasmids are listed in the Supplementary Information Table S1 ...
-
bioRxiv - Genetics 2019Quote: ... PCR was performed using Phusion high-fidelity DNA polymerase according to the manufacturer’s recommendations (New England BioLabs Inc., Ipswich, MA, U.S.A.) and primers (Supplementary Table 15 ...
-
bioRxiv - Biochemistry 2019Quote: ... The SpCas9 variants designed for site-specific labeling were constructed by QuikChange site-directed mutagenesis with Q5® High-Fidelity DNA Polymerase (NEB) and confirmed by DNA sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... Primers 5’Pcrz1 and 3’Tcrz1 (Additional file 1:Table S1) were used to amplify the deletion cassette from the yeast genome using Phusion® High-Fidelity Polymerase (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... three sets of ligation reactions were set up by incubating 600 ng of purified digested DNA with 2 µl of high-concentration T4 DNA ligase (NEB, M0202T) overnight at 4C in a volume of 400 µl ...
-
bioRxiv - Synthetic Biology 2020Quote: ... was then PCRed using P5 and a barcoded version of SGR-176 (see Table S2) the Q5 Hot Start High Fidelity 2x Master Mix (NEB, M0492L) with the following settings ...
-
bioRxiv - Molecular Biology 2020Quote: ... 46 separate 60 μl PCR reactions were performed with 1 μg gDNA in each reaction using Q5® High-Fidelity DNA Polymerase (New England Biolabs). For the zeocin treated sample the total amount of genomic DNA harvested was used ...
-
bioRxiv - Biochemistry 2020Quote: ... Variable regions of transcripts were PCR-amplified for 35 cycles using high-specificity primer pairs designed to minimize cross-hybridization between CaMKII genes (Supplementary table XX) using either Phusion polymerase (NEB #M0530) or KAPA HiFi polymerase (Roche) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The genes of interest were amplified by polymerase chain reaction (PCR) using Q5 high fidelity DNA polymerase (New England BioLabs, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was amplified via polymerase chain reaction (PCR) using the proof reading Phusion® high fidelity (HF) polymerase (Phusion) (New England Biolabs). Reactions were heated to 98 0C for 30 s ...
-
bioRxiv - Plant Biology 2021Quote: ... 2.5 µl 25 µM Custom Nextera PCR Primer 2 and 25 µl NEB Next High Fidelity 2x PCR Master Mix (NEB, #M0541) with 1 cycle of (72°C for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... the ARTIC nCoV-2019 V3 Primer set (IDT) and the Q5 Hot Start High-Fidelity 2X Master Mix (NEB, Cat#M0494S) were used with modified manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Colony PCRs were carried out in 12.0 μL final volumes containing: 5 μL of high-fidelity OneTaq® QuickLoad® 2X Master Mix (New England Biolabs), appropriate forward and reverse control primers (both 0.4 μM ...
-
bioRxiv - Plant Biology 2019Quote: PCR amplification of the candidate gene using BAC clone as a template was carried out with Q5 High-Fidelity DNA Polymerase (New England Biolabs, USA). The amplified product was cloned into a modified binary vector pCGMCP22 (Arumugam et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... in which primers designed to bridge the deleted sequence as described in Figure S1C were used in a PCR reaction with Q5® High-Fidelity DNA Polymerase (New England Biolabs) to amplify the modified vector ...
-
bioRxiv - Genetics 2020Quote: ... 1μl of S2R+ or fly genomic DNA was used in a PCR reaction using Q5 High-Fidelity DNA Polymerase (NEB M0491L). Primer pairs (Supplemental File 2 ...
-
CRISpy-pop: a web tool for designing CRISPR/Cas9-driven genetic modifications in diverse populationsbioRxiv - Genetics 2020Quote: The 3’ and 5’ sections of the donor DNA were first amplified individually using gradient PCR with annealing temperatures from 50°C – 70°C and Phusion® High-Fidelity DNA Polymerase (New England Biolabs). The two individual sections were then joined into the complete donor DNA fragment using the same gradient PCR protocol ...
-
bioRxiv - Physiology 2021Quote: ... the cDNA template was synthesized using NEBNext Second Strand Synthesis Enzyme Mix for ds cDNA and Phusion® High-Fidelity DNA Polymerase (M0530, NEB). For constitutive expression ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: PCR amplification were performed according to the manufacturer’s recommendations with the Phusion High Fidelity Polymerase (New England BioLabs, Ipswich, MA, USA) using cDNA as template ...
-
bioRxiv - Microbiology 2021Quote: Cloning of the plf gene clusters and plfG and papG genes encoding the different classes of adhesins were obtained by PCR amplification using specific primers (Table 2) and Q5 High Fidelity-DNA polymerase (New England Biolabs [NEB]). The A-Tailing Kit (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: minD,minE and FtsA genes were amplified by standard polymerase chain reaction (PCR) amplified using Phusion High-Fidelity DNA polymerase (New England Biolabs, USA) as previously reported24,30 ...
-
bioRxiv - Cell Biology 2021Quote: ... ORF was amplified from MCF10A human mammary cells using specific primers (listed in Table S2) with Q5 High-Fidelity 2X Master Mix (New England BioLabs, # M0492), following the manufacturer’s instructions ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: sgDNA template was generated using gene-specific oligonucleotides and constant oligonucleotide by polymerase chain reaction for 30 cycles using Q5 high fidelity polymerase (NEB, USA). PCR product was further purified using Magbio Hiprep PCR cleanup system (Magbiogenomics ...
-
bioRxiv - Neuroscience 2020Quote: ... amino acid sequence identical to GenBank: BC002453.2) was amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich MA, USA) and inserted into the TOPO cloning site in pET151/D-TOPO E ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Microbiology 2021Quote: ... and ChCEC6 were amplified using primers listed in Supplementary Table 3 and Phusion® High-Fidelity DNA Polymerase (New England Biolabs), then cloned into pCR8/GW/TOPO (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed with primers described in Table S2 according to the Phusion® High-Fidelity DNA polymerase supplier recommendations (New England Biolabs). Genomic DNA sequencing was performed using the 1F_typeIII primers (Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of 1×108 blood stage was extracted for conventional PCR amplification with a Q5® High-Fidelity DNA polymerase (New England Biolabs) from the interference inserts corresponding to the sense and anti-sense fragments of a portion of 429 bp AKT-like genomic sequence of T ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Reverse transcription was carried out via SuperScript IV and cDNA was posteriorly amplified using Q5® High-Fidelity DNA Polymerase (NEB) with the ARTIC nCov-2019 primers and following the recommendations in the sequencing protocol of the ARTIC Network (https://artic.network/ncov-2019) ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments located upstream and downstream to the epitope insertion sites were amplified by PCR using the Q5® High-Fidelity 2 × Master Mix (NEB) with relevant primers (Table 1 ...
-
bioRxiv - Immunology 2020Quote: ... First-round Ig-encoding sequence amplification (20 cycles) was performed using Q5 High-Fidelity Master Mix (New England BioLabs, Ipswich, MA) and nested gene-specific primers ...
-
bioRxiv - Immunology 2020Quote: ... We ran the genotyping PCR for the Rosa26 and the collagen status with the Phusion® High Fidelity DNA Polymerase (New England Biolabs) and the same primers as described previously and indicated in the Supplementary Table 2 [6].
-
bioRxiv - Genomics 2021Quote: ... Tagmented DNA fragments were amplified by adding 12 µL PCR master mix composed of 11 µL Q5 High-Fidelity 2x Master Mix (New England Biolabs, #M0492) and 0.5 µL each of 10 mM Nextera i5 and i7 index primers ...
-
bioRxiv - Genomics 2020Quote: ... and used for PCR amplification of the target region using the Q5® Hot Start High-Fidelity 2× Master Mix (NEB), followed by evaluation of the PCR products by gel electrophoresis and purification with the Qiaquick PCR purification kit (28104 ...
-
bioRxiv - Cell Biology 2020Quote: ... Qualitative PCR was set up in 200 μl PCR-SoftTubes (Biozym Scientific GmbH, Hessisch Oldendorf, Germany) using Q5 High-Fidelity DNA Polymerase (New England Biolabs (NEB), Frankfurt am Main ...
-
bioRxiv - Genomics 2021Quote: ... PCR amplification of the samples was performed using Nextera primers 1 and 2 and NEBNext High fidelity master mix (NEB, M0541S) for 12 cycles as determined by KAPA Real-Time Library Amplification Kit (Peqlab ...
-
bioRxiv - Genomics 2021Quote: ... 46 and Carøe et al 45 and amplified with Phusion® High-Fidelity PCR Master Mix with HF buffer (New England Biolabs Inc). The appropriate number of cycles were determined using Mx3005 qPCR (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: PCR amplification of DNA fragments was performed using Q5 High-Fidelity DNA Polymerase (Cat. #M0491, New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... containing either 20 or 39 times the G4C2 sequence were created (Gen-Script) and amplified using NEB®Stable Competent E.coli bacteria (High Efficiency, New England BioLabs Inc.), according to the protocol for cloning DNA containing repeat elements (C3040 ...
-
bioRxiv - Microbiology 2022Quote: ... For this Reverse transcription was carried out via SuperScript IV and cDNA was posteriorly amplified using Q5® High-Fidelity DNA Polymerase (NEB) with the ARTIC nCov-2019 primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... were used to amplify these dsRNA-complementary sequences from Drosophila genomic DNA with the Q5® Hot Start High-Fidelity 2X Master Mix (NEB). The PCR product was precipitated in 1 volume isopropanol and 1/10 3M sodium acetate for 5 min at room temperature ...
-
bioRxiv - Biophysics 2022Quote: ... to 10 and either GFP11 variant M3 or M4 were synthesized by overlap extension PCR using the Phusion High Fidelity Polymerase (New England Biolabs, USA). For this work ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... DNA fragments were amplified with 15-20 bp of homology regions in primers using Phusion R High Fidelity DNA polymerase (New England Biolabs; NEB) and homology based assemblies were performed using NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Biochemistry 2022Quote: The P562del and Exo+THR mutants were generated on the pET23-P2-D12A-THR (Table S1) background through inverse Polymerase Chain Reactions (iPCR) using Q5® High-Fidelity DNA Polymerase (NEB) following the manufacturer’s instructions in 25 μl reactions with primers p2_thumb_loop_R/DEL1 (Table S2 ...
-
bioRxiv - Biochemistry 2022Quote: ... The PaPPase gene was PCR amplified (Q5® Hot Start High-Fidelity 2X Master Mix from NEB, Frankfurt am Main, Germany) with primers introducing a GG-linker along with a 5’ SalI (TTT TTT GTC GAC ATG CAT CAC CAT CAC CAT CAC GGT GGA AAT ATG ATA AGC TAT GCC TTA CTA GG ...
-
bioRxiv - Bioengineering 2022Quote: ... encompassing the targeted loci were generated using 1 μl of the zebrafish lysate with Phusion® High-Fidelity Polymerase (New England Biolabs) and primers listed in Supplemental Table S3 ...