Labshake search
Citations for New England Biolabs :
4151 - 4200 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... PCR products with homologous DNA sequences (1 to 1.5 kb) flanking the deleted region were PCR-amplified with Phusion High-Fidelity DNA Polymerase (NEB, Ipswich MA, USA). These flanking PCR products were fused to two sides of either a NEO or NAT dominant selectable marker via overlap PCR ...
-
bioRxiv - Genomics 2021Quote: ... thirty-two 50 µl PCR reactions were performed using 500 ng genomic DNA for each reaction and NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, M0541S). The purified libraries were sequenced on the NovaSeq 6000 with 150-bp paired-end sequencing ...
-
bioRxiv - Genetics 2020Quote: ... All the PCR was performed using NEBNext® High-Fidelity 2X PCR Master Mix (Catalog number: M0541L, New England Biolabs Inc., USA) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Inverse PCR was performed on the ligated genomic DNA using Q5 Hot Start High-Fidelity DNA Polymerase (M0493L, NEB, Ipswich, MA, USA). PCR products underwent primer walking Sanger sequencing (Sterky and Lundeberg ...
-
bioRxiv - Cell Biology 2020Quote: ... TopBP1 full-length cDNA (a kind gift from Lee Zou) was amplified by PCR with primers 1 and 2 using Phusion® High-Fidelity DNA Polymerase (New England Biolabs, CM0530). The forward and reverse primers contain AscI and NotI sites ...
-
bioRxiv - Immunology 2021Quote: ... was isolated from cDNA of devil peripheral blood mononuclear cells (PBMCs) by PCR using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: ... Genomic loci were then amplified using primers targeting genes of interest (see Table S9 for a list of primers) using Q5 Hot Start High-fidelity 2X Master Mix (NEB, Cat. #M0494). One exception was the CHD sextyping amplification protocol ...
-
bioRxiv - Genetics 2020Quote: Genomic DNA from wildtype animals (N2) and from strains bearing the hcp-6(mr17) mutation was amplified using a high-fidelity polymerase (Phusion®, NEB #M0530S) and the following primer pairs:
-
bioRxiv - Cancer Biology 2022Quote: ... initial PCR amplification of sgRNA cassettes adding overhang adapter sequence was performed using Q5® Hot Start High-Fidelity 2X Master Mix (NEB, M0494S). For each sample ...
-
bioRxiv - Biophysics 2022Quote: ... The construction of the fn3sumo gene was made based on ySMB9.41 The cDNA sequence of all three fibronectin derivatives was first amplified using Q5 high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA) from their respective template DNA ...
-
bioRxiv - Cell Biology 2022Quote: Amplicons of tagged-Cdep were isolated by gel extraction after PCR amplification using Phusion high fidelity polymerase (New England Biolabs, catalog #E0553L). The amplicons were then cloned into the pJFRC7 5x UAS vector (ref ...
-
bioRxiv - Developmental Biology 2022Quote: Sense and antisense RNA probes for in situ hybridization were amplified using Q5® high- fidelity DNA polymerase (New England BioLabs, USA) with the T7 promoter extension to the 5’ of primers (primers used can be found in Table S1H) ...
-
bioRxiv - Genomics 2022Quote: The bead-bound ligation products were amplified 8-13 cycles by PCR (Supplementary Information Table 5 for cycle recommendations according to starting cell number) using Phusion high-fidelity PCR master mix with HF buffer (New England Biolabs cat. #M0531L)
-
bioRxiv - Genomics 2022Quote: ... and the library was amplified 4 cycles by PCR using Phusion high-fidelity PCR master mix with HF buffer (New England Biolabs cat. #M0531L). Finally ...
-
bioRxiv - Genomics 2022Quote: ... we amplified a 150 bp sequence using primers pGL3-CDC20_F and pGL3-CDC20_R (Phusion High-Fidelity PCR Master Mix, NEB M0531, Supplemental Table 5) that added restriction sites for SacI and XhoI to the 150 bp sequence ...
-
bioRxiv - Microbiology 2022Quote: Single-stranded cDNA was used as a template for PCR amplification to amplify all eight genes using segment specific primers using high-fidelity Phusion 2X DNA polymerase (New England BioLabs, Inc., USA). Primer sequences are available in the GitHub repository accompanying this manuscript 33 ...
-
bioRxiv - Plant Biology 2022Quote: ... and the entire upstream region before the end of the previous gene (875 base pairs) using the Phusion® High-Fidelity DNA Polymerase (New England Biolabs M0530S) from WT Col-0 genomic DNA extracted from leaf tissue ...
-
bioRxiv - Immunology 2024Quote: ... and PCR amplification of the gRNA insert was done on 2000 genomes per sample using Q5® Hot Start High-Fidelity DNA Polymerase (NEB # M0493) with P5 and P7 primers that included the Genewiz partial adapter sequence (Table S1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-PCR was performed with 2 μl of the reverse transcription positive reactions and Phusion High Fidelity DNA polymerase (NEB, Ipswich, MA) following manufacturer’s protocols on an Applied Biosystems 2720 Thermal Cycler ...
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified from the corresponding pCMV6-AN-mGFP-PRR14 full-length vectors using Q5 Hot-start High-Fidelity Polymerase 2x Mix (New England Biolabs, cat# M0494S) and the following primers containing EcoRI and AgeI restriction sites (Forward (EcoRI) ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified from the corresponding pCMV6-AN-mGFP-PRR14 full-length vectors using Q5 Hot-start High-Fidelity Polymerase 2x Mix (New England Biolabs, cat# M0494S) and the following primers containing HindIII and RsrII restriction sites (Forward (HindIII) ...
-
bioRxiv - Biochemistry 2024Quote: ... 100 ng of template DNA was used in a 2 hour in vitro transcription reaction using the HiScribe T7 High Yield RNA (New England Biolabs, Cat. E2040S) kit according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PAGFP-TIRR plasmid was generated by amplifying a PAGFP fragment from a pPAGFP-C1 plasmid and a backbone containing TIRR using Q5® High-Fidelity DNA Polymerase and associated Q5® Reaction Buffer and GC enhancer (New England Biolabs). The PAGFP fragment was inserted C-terminally to TIRR.
-
bioRxiv - Immunology 2024Quote: ... The region after the TRR to the middle of exon 1 was amplified from 50 ng of gDNA using Phusion® High-Fidelity polymerase (New England Biolabs, M0530) according to the manufacturer’s instructions with the following primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... RUW regions were amplified from genomic DNA of transfected populations via PCR with the high fidelity Q5 polymerase (New England Biolabs, Cat. #M0491S), with an annealing temperature of 62 degrees and performing 35 cycles ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR cycles were carried out with Illumina Nextera adapter primers using the NEBNext High Fidelity 2x Master Mix (NEB, Cat# M0541S) using the following PCR program ...
-
bioRxiv - Microbiology 2023Quote: ... 9 DNA fragments encoding the partial genome of SARS-CoV-2 were prepared by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Cat# M0491S). A linker fragment encoding hepatitis delta virus ribozyme ...
-
bioRxiv - Genetics 2023Quote: ... 5’ and 3’ homology arm flanking the C-terminal insertion site was amplified from N2 genomic DNA using the Q5® High-Fidelity DNA Polymerase (NEB, M0491L), followed by HiFi DNA assembly (NEB ...
-
bioRxiv - Immunology 2023Quote: ... Each PCR (performed in triplicate for each sample) was done in a 25 μl volume using Q5 High-Fidelity 2X Master Mix (NEB, cat# M0492L), 5 pmol of each primer and 50 ng template DNA ...
-
bioRxiv - Immunology 2023Quote: ... The multiplex products were used as templates to the second PCR using Phusion High-Fidelity DNA Polymerase (New England Biolabs Inc., M0530L) that barcodes each well/perturbation separately ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Microbiology 2023Quote: ... and amplified with the primers (5’-CAA GAC TAG TGG AAG CGG AGC TAC TAA CTT CAG CCT GCT GAA GCA GGC TGG CGA CGT GGA GGA and 5’-NNN NAC GCG TCT AGC CTT CCC AGA CGT ACC C) using high-fidelity Phusion polymerase (NEB, Cat# M0530S). The PCR fragment was digested with BmtI and MluI ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Bioengineering 2023Quote: ... from the AAV genomes following the fourth round of selection by PCR using Q5 High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA) and 21 cycles of PCR ...
-
bioRxiv - Immunology 2023Quote: ... using primers that overlapped with pLenti-EF1-Blast at the xho1 site on the 5’ end and overlapped with the 5’-end of the RNase L coding sequence on the 3’-end (Supplementary table 1) and NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs: M0541S). RNase L coding sequence was amplified using a 3’-end primer that overlapped with pLenti-EF1-Blast at the xba1 site ...
-
bioRxiv - Microbiology 2023Quote: Amplification of the V3-V4 hypervariable regions of the 16S rRNA gene was carried out using the Q5 high-fidelity DNA polymerase (New England Biolabs, Ipswich, USA). The PCRs were performed in 50 µl reactions ...
-
bioRxiv - Microbiology 2023Quote: ... the Strep-tag® II sequence was inserted at the C-terminus via Phusion® High-Fidelity DNA Polymerase mutagenesis PCR (New England Biolabs) using the primers pYS14_GA_F/ 5’ phosphorylated flaakstrp14R to amplify the whole plasmid ...
-
bioRxiv - Synthetic Biology 2023Quote: BigBlocks were PCR-amplified with dedicated primer pairs in a 25.0 μL PCR reaction mix composed of 0.25 μL Q5® Hot Start High-Fidelity DNA Polymerase 2 U/μL (NEB® M0493), 5.0 μL Q5® 5X buffer (NEB® B9027) ...
-
bioRxiv - Microbiology 2023Quote: ... and used as “megaprimers” that are denatured and annealed to the original plasmid (pNG93) to amplify the vector backbone using Q5® High-Fidelity 2X Master Mix (NEB, M0492S). The reactions were then digested with DpnI to eliminate any remaining parental plasmid DNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The backbone of the library was amplified from pTL002 with homology tails by Q5 Hot Start High-Fidelity 2X Master Mix (NEB CN# M0494S). 125-nt ssDNA with 9 random nucleotides at the RBS and the first base of the start codon region was synthesized by Eurofins ...
-
bioRxiv - Biophysics 2023Quote: ... CBD binding site mutants were generated using the two-step PCR method using Phusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich MA), T4 ligase Quick Ligation kit (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2023Quote: We designed amplification primers for the extracted assembly sequences using Geneious Prime (Biomatters Ltd) and generated PCR amplicons using Q5 High-Fidelity 2X Master Mix (New England Biolabs catalog # M0492), Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs catalog # M0531) ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Cell Biology 2023Quote: Mutagenesis and all DNA modifications were carried out using Q5 Hot Start high- fidelity 2X Master Mix (New England BioLabs, Cat# M0494L) using the recommendations of the manufacturer ...
-
bioRxiv - Systems Biology 2023Quote: The site directed mutagenesis (Liu and Naismith, 2008) was performed using the Phusion High Fidelity DNA Polymerase (New England BioLabs GmbH, E0553L). 3.5ng template DNA as well as 5µM of each primer were used ...
-
bioRxiv - Systems Biology 2023Quote: ... The two intermediate libraries were cloned together using high-efficiency cloning and standard restriction enzyme-mediated cloning with enzymes AvrII (New England Biolabs, Ipswitch, MA) and HindIII-HF (New England Biolabs ...
-
bioRxiv - Systems Biology 2023Quote: ... a barcode fragment was generated by PCR-amplifying a 326 bp amplicon from the pDL00210 template and using the Q5 High-Fidelity 2X Master Mix (New England Biolabs, Ipswitch, MA) and primers oDL00747 and oDL00748 ...
-
bioRxiv - Systems Biology 2024Quote: ... The dsRNA sequence region of each gene was amplified with the gene-specific primer pair using Q5 high-fidelity PCR (New England BioLabs, Ipswich, MA). The sense and antisense dsRNA sequence fragments conjugated with the T7 promoter sequence were amplified separately using the previous PCR amplicons as templates ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA synthesis across the methylated linearized pBlueScript template was subsequently performed in Q5® High-Fidelity 2X Master Mix (New England Biolabs, Inc.) using a 5’ biotinylated primer (5’-/5Biosg/CGTTCTTCGGGGCGAAAACTCTCAAGG −3’ ...