Labshake search
Citations for New England Biolabs :
4101 - 4150 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... 8 mM ATP and 10 units of T4 ligase (NEB) were incubated overnight at 16°C ...
-
bioRxiv - Immunology 2023Quote: ... 10 μL of 5x HF Buffer (NEB, cat. no: M0530L), 2.5 μL of 10 μM m-alpha-RC1 primer ...
-
bioRxiv - Systems Biology 2023Quote: ... 1000 μL of 10 × T4 DNA Ligase Reaction Buffer (NEB), 50 μL of 20 mg/mL BSA (TaKaRa) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... All injection mixes included 10% phenol red (New England Biolabs) for tracing of injection mix ...
-
bioRxiv - Genomics 2024Quote: ... add 8 ul of RNAse A (NEB, 10 mg/ml), and incubate 1 h at 37 C being careful there is no condensation on lid.
-
bioRxiv - Genetics 2024Quote: ... and then transformed into 10-beta competent cells (NEB, C3020) via electroporation ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Illumina sequencing adaptor ligation (New England BioLabs, E6000B-10) as previously published67 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 µl GTP (10 μmol) (New England BioLabs, Ipswich, MA), 7.5 µl m7G(5′)ppp(5′)G RNA Cap Structure Analog (10 μmol ...
-
bioRxiv - Molecular Biology 2024Quote: T4 RNA ligase I 10 U/µL (NEB, Cat#M0204S)
-
bioRxiv - Systems Biology 2024Quote: ... and 2 μL of T4 PNK (10 U/μL, NEB) were added ...
-
bioRxiv - Genomics 2021Quote: ... using the Golden Gate assembly kit (NEB® Golden Gate Assembly Kit #E1601). Each guide sequence was cloned with its own U6 promoter and was followed by a sgRNA scaffold ...
-
bioRxiv - Microbiology 2023Quote: ... A RNA cleanup kit (Monarch RNA Cleanup Kit T2050, New England Biolabs, France) was used to further clean the RNA samples ...
-
bioRxiv - Plant Biology 2020Quote: ... The amplification of the GC-rich region (primer 1) was performed with high fidelity Q5 polymerase (New England Biolabs Inc, Ipswich, MA) using the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Amplification of cDNA ends was carried out using step-out PCR as previously described (Matz et al., 2003) with the Q5 Hot Start High-Fidelity DNA Polymerase (M0493L, NEB, Ipswich, MA).
-
bioRxiv - Developmental Biology 2020Quote: ... RFP-histone H2B fusion protein (pRN3-C-term-RFP-Hist1h2bb) derived by in frame cloning of a high-fidelity PCR amplified cDNA (Phusion® DNA polymerase, New England BioLabs, M05305) encoding histone H2B (Hist1h2bb ...
-
bioRxiv - Developmental Biology 2020Quote: The lft2 exon regions were amplified by PCR from genomic DNA isolated from tail fin clips of a surface fish and individual F61 PA-CF male and females using the Phusion High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA) and the primers listed in Table S3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... eluted in 20 μl of water and PCR amplified using 25 μl NEB Next High-Fidelity 2x PCR Master Mix (NEB, #M0541 L), 2.5 μl of P5_BRB primer (5 μM ...
-
bioRxiv - Immunology 2021Quote: ... 45 μl of cDNA from the synthesis reaction was mixed with primers and Q5® High-Fidelity 2X Master Mix(NEB, USA). The PCR program began with an initial denaturation at 95°C for 1.5minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... and the region surrounding the protospacer adjacent motif (PAM) was amplified with Phusion® High-Fidelity DNA Polymerase (New England Biolabs, #M0530). PCR products were purified using the QIAquick PCR Purification Kit (QIAGEN ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mlrA gene was amplified from the MlrA-expression plasmid pASKA-MlrA (Table EV2) by PCR using Phusion High-Fidelity DNA polymerase (New England Biolabs, Tokyo, Japan) and the primer set Pure-Niwa-F and Pure-Niwa-R (Table EV3) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A PCR reaction adding a T7 promoter/terminator pair on each aptamer (see Table 1) was carried out using Q5 High-Fidelity DNA Polymerase (New England Biolabs Inc.(NEB) #M0491 ...
-
bioRxiv - Physiology 2019Quote: ... gene-specific oligonucleotides targeting this region (see Table S1) were designed to amplify this predicted partial fragment using Q5 High Fidelity DNA Polymerase (New England Biolabs, Whitby, On) with whole adult female A ...
-
bioRxiv - Microbiology 2019Quote: ... Earth Microbiome primers and thermocycler protocol (Caporaso et al., 2012) in 25-μl reactions containing Phusion High-fidelity Master Mix (New England Biolabs, Ipswich, MA), 0.25μM of each primer ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 µl of genomic DNA was used for screening by PCR amplification (Phusion® High-Fidelity PCR Master Mix with HF Buffer, NEB, M0531S) of the targeted genomic region ...
-
bioRxiv - Neuroscience 2021Quote: ... the Irk1WT and Irk1V306A open reading frames were amplified from pENTR-Irk1WT or pENTR-Irk1V306A by PCR (Phusion high-fidelity DNA polymerase, New England Biolabs Cat #M0530). Primers pAc5-Irk1-F and pAc5-Irk1-R included additional sequence for subsequent Gibson assembly cloning into the multi-cistronic vector ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Twenty-four PCR reactions (24 x 50 μl) were performed with 1 U of Q5 high-fidelity polymerase (New England Biolabs®, M0491), 200 μM dNTPs ...
-
bioRxiv - Biochemistry 2021Quote: ... The relinearized single-stranded DNA template was subjected to PCR amplification by using barcoded primers for Illumina TrueSeq small RNA sample and Phusion High-Fidelity DNA Polymerase (2 U; M0530L, NEB, Ipswich, MA). Subsequently ...
-
bioRxiv - Biochemistry 2021Quote: ... Vectors used to construct plasmids containing the bbu genes were linearized by PCR amplification from 10 ng vector template DNA in a 50 μL reaction containing 0.5 μM of forward and reverse primers (Dataset S5) and Phusion High-Fidelity PCR Master Mix with HF buffer (New England Biolabs, Ipswich, MA). Thermocycling was carried out in a Bio-Rad C100 thermal cycler using the following parameters ...
-
bioRxiv - Biochemistry 2021Quote: ... timonensis SN18 gDNA in a 50 μL reaction containing 0.5 μM of forward and reverse primers (Dataset S5) and Phusion High-Fidelity PCR Master Mix with HF buffer (New England Biolabs, Ipswich, MA). A plasmid based on the pET28a(+ ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNAs were subcloned into vectors through conventional ligation with Ligation high Ver.2 (Toyobo, Osaka, Japan) or NEBuilder HiFi DNA Assembly (New England Biolabs, Ipswich, MA) according to the manufacturers’ instruction ...
-
bioRxiv - Microbiology 2020Quote: ... reverse primer S-D-Bact-0785-b-A-18 (5’ TAC NVG GGT ATC TAA TCC 3’) and a high fidelity Taq polymerase master mix (Q5, New England Biolabs, Massachusetts, USA). Primer sequences were based on Klindworth et al.24 ...
-
bioRxiv - Cell Biology 2021Quote: All PCR amplifications were performed using Q5™ High-Fidelity DNA polymerase at the annealing temperature and extension times recommended by the manufacturer (Biolabs #M04915). PCR fragments and plasmids were respectively purified with NucleoSpin® Gel and PCR cleanup (Macherey-nagel # 740609 ...
-
bioRxiv - Neuroscience 2022Quote: ... SARS-CoV-2 cDNA was subsequently amplified using ARTIC network v2 primers using two-step PCR amplification with Q5® High-Fidelity DNA Polymerase (New England Biolabs, USA). PCR fragments were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR was carried out on 100 ng of gDNA per sample using Phusion High-Fidelity DNA Polymerase (New England Biolabs, Hitchin, UK) with an initial denaturation phase (98°C for 30 seconds) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Flag/V5-tagged TCF7L2 and Flag-tagged FOXQ1 truncation constructs were generated by restriction cloning using the high fidelity Q5 polymerase (New England Biolabs, Ipswich, US). For cloning of FOXQ1 truncation constructs ...
-
bioRxiv - Microbiology 2021Quote: ... The construct was amplified by 2-step PCR according to manufacturer recommendations using Q5 high fidelity polymerase (New England Biolabs, cat#M0494S) with primers 6469TSC and 6470TSC (Supplemental table 1) ...
-
bioRxiv - Physiology 2021Quote: ... and 72 °C for 5 min) using a Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) and primers containing the restriction sites of SpeI or BglII for subsequent subcloning (F ...
-
bioRxiv - Immunology 2019Quote: ... Then sgRNA template for in vitro transcription (IVT) was prepared by PCR amplification of Phusion high fidelity DNA polymerase (NEB Biolabs, Ipwich, MA), the PCR mixture was cleaned up by PCR cleanup reaction (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... PCRs were performed in 25 μL reaction volumes and contained 13 μL Q5® Hot Start High-Fidelity 2× Master Mix (New England Biolabs, US), 0.5 μM of each primer and 0.4 μL of 25 mg/mL BSA ...
-
bioRxiv - Microbiology 2022Quote: ... The V4 hypervariable region of the 16S rRNA bacterial gene (515-806) was amplified using specific primers with the barcodes with Phusion High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, USA). PCR amplicons from each sample were pooled in equimolar amounts and purified using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Genetics 2022Quote: The full-length ccf-1 cDNA clone was generated through PCR using the Q5® High-Fidelity DNA polymerase (New England BioLabs, M0491L) and cloned into the pDEST32 vector containing the GAL4 DNA binding domain (DBD ...
-
bioRxiv - Synthetic Biology 2022Quote: ... encoding a 7-mer insertion between amino acid residues 588 and 589 of AAV9 was used as the reverse primer along with the Assembly-Xbal-F oligo (CACTCATCGACCAATACTTGTACTATCTCT) as a forward primer in a PCR reaction using Q5® High-Fidelity 2X Master Mix (NEB #M0492S) following the manufacturer’s protocol for 30 cycles with 10 ng pUC57-wtAAV9-X/A plasmid.
-
bioRxiv - Plant Biology 2019Quote: ... the sequence encoding PL1 (with no stop codon) was amplified using standard PCR reactions with a high fidelity Phusion Taq polymerase enzyme (New England Biolabs, Hitchin, UK) and appropriate templates ...
-
bioRxiv - Genetics 2020Quote: ... V416I and S438N were modified by site-directed mutagenesis PCR using Phusion®High-Fidelity DNA Polymerase (New England Biolabs, Massachusetts, USA). pGEMHE constructs were linearized using sbfI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA substrates used for digestion reactions were either generated by PCR using Q5® High-Fidelity 2X Hot Start Master Mix (NEB #M0494), oligonucleotides produced by IDT ...
-
bioRxiv - Plant Biology 2019Quote: ... A total of 500 ng of high-quality genomic DNA per individual was digested with EcoRI and MspI (New England Biolabs, Ipswich, MA). 50 ng of each digestion reaction was ligated to barcoded adapters and pooled in 48 samples group ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cDNAs were subcloned into vectors through conventional ligation with Ligation high Ver.2 (Toyobo, OSAKA, Japan) or NEBuilder HiFi DNA Assembly (New England Biolabs, Ipswich, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... individual oligo libraries were PCR-amplified using 15 nt amplification primers with Q5 High-Fidelity 2X Master Mix (New England Biolabs, Ipswitch, MA), and number of cycles determined by qPCR ...
-
bioRxiv - Physiology 2021Quote: The open reading frame of ayRhp1 was amplified from pCR2.1 TOPO-ayRhp1 vector (see cloning of ayRhp1) using Q5 high fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA) and the restriction site-containing primers (forward primer ...
-
bioRxiv - Microbiology 2020Quote: ... PCRs were performed in 25.0 μL reactions containing: 12.5 μL of high-fidelity Taq DNA polymerase (Phusion® Master Mix, New England Biolabs, Ipswich, MA, USA), forward and reverse primers (both 0.4 μM) ...