Labshake search
Citations for New England Biolabs :
4051 - 4100 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... The PCR was performed in a total volume of 50 µl containing 1× HF buffer (New England BioLabs), 1 µl dNTP Mix (New England BioLabs) ...
-
bioRxiv - Physiology 2023Quote: ... muGFP and homology arms were PCR-amplified using Q5 High-Fidelity 2× Master Mix (New England BioLabs, M0492L). Primers for PCR were designed using the NEBuilder Assembly Tool ...
-
bioRxiv - Microbiology 2023Quote: ... Purified PCR products were incubated together in a thermocycler with 1X Hi-Fi DNA Assembly master mix (NEB) at 50°C for one hour ...
-
bioRxiv - Genomics 2023Quote: ... was subcloned into the pIRES2-dsRED2 plasmid using PCR with ag409 and ag410 and NotI restriction digestion (NEB) to create KCNE1-HA:pIRES2:dsRED2 ...
-
bioRxiv - Immunology 2023Quote: ... PCR enrichment of adaptor-ligated DNA was performed using NEBext Multiplex Oligos for Ilumina (NEB #E7335S and #E7500S) following the recommended number of amplification cycles based on the amount of cDNA input used in the fragmentation/end prep reaction ...
-
bioRxiv - Microbiology 2023Quote: ... The 720 bp lpxE gene was amplified by PCR from pUC57::lpxE using Q5 polymerase (New England Biolabs) and primer set lpxE-F/lpxE-R ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR products were digested using ClaI and BamHI in 1X Cutsmart buffer (New England Biolabs, Ipswich, MA) and ligated into the pCW57 backbone using T4 DNA ligase ...
-
bioRxiv - Biophysics 2023Quote: ... In the first reaction we made a PCR-fragment with Q5 DNA polymerase (M0491, New England Biolabs, UK) using primers JT403 (CCTGTAGTCTTCTTAATTAAGACGTCAG ...
-
bioRxiv - Cancer Biology 2023Quote: ... and mRNA expression was quantified by qRT-PCR using 2X Luna Universal qPCR Master Mix (New England Biolabs) on a QuantStudio 3 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... Promoters and coding sequences were commercially synthesized (Eurofins) or PCR-amplified using the Q5 high fidelity polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: The DASHed library was PCR amplified with NEBNext Ultra II Q5 High-Fidelity 2X Master Mix (NEB, M0544) and 0.5 uM PCR primers with unique dual index using the two-step PCR cycles:
-
bioRxiv - Systems Biology 2023Quote: ... with 1.5 µg undigested genomic DNA per PCR reaction using Q5 HotStart High Fidelity Polymerase (New England Biolabs). Resulting PCR product from multiple reactions per sample were pooled ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All reporters were constructed by site-directed mutagenesis via PCR sing Q5® High-Fidelity DNA Polymerase (NEB) to create overlaps forming the Fetch sequence followed by Gibson assembly and transformation into DH10β cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... we PCR amplified ars1 (Heyer et al. 1986) from pMZ379 with primers 439 & 440 and Gibson assembled (NEB) this with a pUC57 or pBN111 backbone amplified with 437 & 438 ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid backbones without eYFP were amplified by PCR with PR41 and PR42 using Q5 Polymerase (New England Biolabs) and pAJM657 ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... Libraries were PCR amplified in 8x 50ul reactions per 10,000 gRNAs (0.5 µl Q5 polymerase (NEB Cat #M0493), 10 µl 5× reaction buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli in vitro transcription were synthesized through a 200 µL PCR reaction containing 10x Taq Buffer (NEB, #B9014S), 250 µM dNTP Mix (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Templates for in vitro transcription were generated by PCR amplification (Q5 High-Fidelity DNA Polymerase, New England Biolabs) from plasmids using a T7 extended primer (5’-CCTAATACGACTCACTATAGGGAG-3’ 85) ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR products were ligated to pUCm-T vector (B522211, Sangon) with Blunt/TA Ligase Master Mix (M0367S, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification at the α-tubulin locus was done using Q5 Hot Start High-Fidelity DNA Polymerase (NEB) with a 30 s extension time ...
-
bioRxiv - Genetics 2023Quote: ... the primary probes were amplified using Phusion® High-Fidelity PCR Master Mix with HF Buffer (M0531S, NEB) by monitoring the amplification on a qPCR machine (CFX Connect ...
-
bioRxiv - Cell Biology 2023Quote: Polymerase chain reaction (PCR) was performed using the Phusion Hot Start Flex 2X Master Mix (New England Biolabs). Reactions were set up according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA library was then prepared for Illumina NGS sequencing by PCR using Phusion HF master mix (NEB) and custom indexed primers for the PTM library 56 ...
-
bioRxiv - Genomics 2023Quote: Primers were used to amplify individual subpools using 25 μL 2x NEBnext PCR master mix (New England Biolabs), 2 μL of oligonucleotide pool (∼40 ng) ...
-
bioRxiv - Genetics 2024Quote: Double-stranded RNA was in vitro transcribed from a PCR amplicon using T7 RNA Polymerase (New England BioLabs) (Extended Data Fig ...
-
bioRxiv - Biophysics 2024Quote: ... Bisulfite-converted libraries were PCR-amplified and uniquely dual-indexed using NEBNext Multiplex Oligos for Illumina (NEB #E6440S) and the Kapa HiFi Uracil+ PCR system (Kapa #KK2801) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification and barcoding performed as described (Hart paper, Cell, 2015) using NEBNext Q5 Ultra mastermix (NEB, # MO544). PCR products were extracted from agarose using a Monarch DNA Gel Extraction Kit (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... using ETAA1 DBR R1 RT-PCR primer 5′-AAGTTCTTCTTCTTGACTTTGTGTT-3′ and treated with RNaseH (New England Biolabs, M0297S). 1μl of the cDNA was used for PCR amplification reactions using using GoTaq® G2 DNA Polymerase (Promega ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic region containing the CRISPR-edit was PCR-amplified using OneTaq polymerases in Standard Buffer (New England Biolabs). After PCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the adaptor ligated DNA was amplified using NEBNext Q5 Hot Start Hifi PCR Master Mix (NEB, M0543). The libraries were sequenced at a rate of 5 million reads per sample ...
-
bioRxiv - Cell Biology 2024Quote: ... The ATAC-seq libraries were constructed and amplified using NEBNext High-Fidelity 2x PCR Master Mix (NEB, #M0541) and SYBR Green I (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: sgRNAs were synthesized (Bhattacharya, Marfo, Li, Lane, & Khokha, 2015) using PCR with Q5 High-Fidelity DNA Polymerase (NEB), 1 µM each of forward and reverse primer and the following cycling conditions ...
-
bioRxiv - Microbiology 2024Quote: ... Each strain was streaked for isolation and PCR was performed with each strain using Taq DNA polymerase (NEB) and the primers and reaction conditions listed in Table S7A to amplify one 610-bp region of the eps locus (NE91_04885) ...
-
bioRxiv - Microbiology 2024Quote: ... and amplified by PCR using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, USA; #M0494) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR was carried out on 200-300 ng of restricted genomic DNA using OneTaq 2X Master Mix (NEB) with primers complementary to sequences within the neo cassette that flanked the intron [Neotet1s ...
-
bioRxiv - Bioengineering 2024Quote: ... The target genomic locus was amplified by PCR using Q5 Hot Start high-fidelity 2X master mix (NEB) and primers listed in Table S3 and purified by PureLink PCR purification kit (Thermo Fisher Scientific) ...
-
A humoral immune response to parasitoid wasps in Drosophila is regulated by JAK/STAT, NF-κB and GATAbioRxiv - Immunology 2024Quote: ... The digested pWallium20 backbone and the amplified PCR fragment were assembled using a HiFi assembly reaction (NEB #E5520), with an incubation time of 1 hour at 50 °C ...
-
bioRxiv - Genetics 2024Quote: We amplified the oligo pool using five cycles of PCR with Phusion High-Fidelity polymerase (New England Biolabs) and primer set KC_1 (Table S4) ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR on both cDNA and gDNA were amplified using OneTaq Hot Start 2X Master Mix (New England Biolabs). cDNA reactions were done using 10% total volume of the reaction as input and 100 ng of gDNA as input ...
-
bioRxiv - Synthetic Biology 2024Quote: All PCR amplifications for plasmid construction and cloning were performed using Q5® High-Fidelity DNA Polymerase (NEB), followed by purification with Monarch® PCR & DNA CleanupKit (NEB) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... extracted PCR product with 2 μl of NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Recovery PCR reactions were carried out with 1 µl of the selection product in Taq DNA polymerase (NEB) reactions with recovery primers (CSR_Rec_SHORT_F1/R1 ...
-
bioRxiv - Genomics 2024Quote: ... 2 μL of 10% Tween-20 and 5 μL NEBNext High-fidelity 2× PCR Master Mix (NEB, M0541) was added to each well sequentially ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... or FLAG (amino acid sequence: DYKDDDDK) with a kit (Gibson assembly kit from New England Biolabs, catalogue # E5510S). The different combinations were cloned into pJFRC7-20XUAS-IVS-mCD8::GFP (Addgene # 26220 ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the NEBNext Ultra DNA Library Prep Kit (kit number E7370L, New England Biolabs) and 8 cycles of PCR ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was isolated from blood (QiaAmp DNA Mini Blood Kit, Qiagen; or Monarch Genomic DNA purification kit, NEB) or from perfused organs homogenized (Fisher Bead Mill 4 ...
-
bioRxiv - Developmental Biology 2021Quote: NEBNext rRNA Depletion Kit (NEB, Cat E6310S) was used to deplete ribosomal RNA according to the manufacture’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... The HiScribe Quick T7 kit (NEB, E2050S) was then used for in vitro transcription ...
-
bioRxiv - Molecular Biology 2020Quote: ... a quick ligation kit (New England Biolabs) was used ...