Labshake search
Citations for New England Biolabs :
3351 - 3400 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... 10 μL re-annealed PCR product was digested with 2 units T7 Endonuclease I (NEB #M0302L) in NEBuffer 2 for 60 min at 37°C ...
-
bioRxiv - Genetics 2020Quote: ... using 12.5 µL of Phusion® High-Fidelity PCR Master Mix NEB (New England Biolabs Inc.), and 2 µl of Illumina forward and reverse [10 µM] primers ™ ...
-
bioRxiv - Genetics 2020Quote: ... Gene amplification reactions were performed using Phusion® High-Fidelity PCR Master Mix (New England Biolabs). Sanger sequencing (Genewiz ...
-
bioRxiv - Genomics 2021Quote: ... Each well contained 50 µL of NEBNext High Fidelity 2X PCR Master Mix (New England Biolabs), 0.5 µL of each primer at 100 µM ...
-
bioRxiv - Developmental Biology 2021Quote: ... The EnVT15159 PCR product was then digested using HindIII and AgeI high fidelity restriction enzymes (NEB) in Cutsmart buffer (NEB).
-
bioRxiv - Biochemistry 2021Quote: ... semi-quantitative PCR with 30 ng cDNA was performed using LongAmp® Taq DNA Polymerase (NEB) with primers in flanking exons detecting both isoforms MALT1A (146 bp ...
-
bioRxiv - Genomics 2021Quote: ... Beads were resuspended in 50 μL PCR master mix (25 μL 2X Phusion HF buffer (NEB), 1 μL 12.5 μM Nextera Ad1 primer (Illumina) ...
-
bioRxiv - Biochemistry 2021Quote: All PCR amplification steps described here were performed using the Phusion High-Fidelity DNA Polymerase (NEB) according to the manufacturer’s protocols ...
-
bioRxiv - Genetics 2021Quote: ... The transposed DNA was converted into libraries using NEBNext High Fidelity 2x PCR Master Mix (NEB) and the Nextera Index Kit (Illumina ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR reactions were conducted using Q5® Hot Start High-Fidelity 2X Master Mix (NEB, M0494L). Ligations were conducted using isothermal assembly with NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... Table 3) region of clpP1 was amplified by PCR (GC buffer, Phusion polymerase, New England Biolabs) using isolated L ...
-
bioRxiv - Developmental Biology 2020Quote: ... Genomic DNA for the inverse PCR was digested with EcoRI-HF (R3101S, NEB, Ipswich, MA, USA). Digested genomic DNA was purified with GeneJET PCR Purification Kit (K0702 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Gas1 were amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase (NEB, M0493L) and cloned using CloneJET PCR Cloning Kit (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... we amplified the ORF genes by PCR and cloned them using the Gibson Assembly protocol (NEB). For the CD95 (303-319 ...
-
bioRxiv - Cell Biology 2021Quote: ... Coding sequences were PCR amplified from cDNA or vectors with Q5 high-fidelity Taq Polymerase (NEB) using the following primers:
-
bioRxiv - Biochemistry 2020Quote: ... Plasmids were generated by Gibson assembly of PCR fragments using the NEBuilder HiFi Master Mix (NEB). Fragments were created by PCR with the relevant primers (listed in Supplementary Table 2 ...
-
bioRxiv - Bioengineering 2021Quote: ... Loci to be sequenced were amplified by PCR with the Q5 DNA polymerase (New England Biolabs) according to the manufacturer’s instructions and sequenced at Microsynth AG.
-
bioRxiv - Genomics 2021Quote: ... The PCR reactions were cleaned up using 0.9X NEBNext Sample purification beads (E7137AA, New England Biolabs) and eluted in 25μL of 0.1X TE ...
-
bioRxiv - Genomics 2020Quote: ... All the PCR reactions were pooled together and treated with 200 U of Exonuclease I (NEB) per ml of PCR reaction for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: 16S ribosomal DNA templates (∼1,465 bp) were amplified using Q5 high fidelity PCR (New England Biolabs) with the universal primer set 27F (5’-AGAGTTTGATCCTGGCTCAG-3’ ...
-
bioRxiv - Immunology 2021Quote: ... PCR reaction was performed using OneTaq® 2× Master Mix with Standard Buffer (New England Biolabs). Primers sequences ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were generated using the Q5 High-Fidelity DNA Polymerase (New England BioLabs, United Kingdom) with 50 ng genomic DNA as template ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR was performed with Nextera-tagged primers under standard Phusion or Q5 Polymerase (New England Biolabs). PCR primers used in this study can be found in Supplementary Table 3 ...
-
bioRxiv - Molecular Biology 2020Quote: All fragments were generated with PCR using Q5 Hot Start High-Fidelity DNA Polymerase (NEB M0493) and gel purified using the QIAquick Gel Extraction Kit (Qiagen 28704 ...
-
bioRxiv - Immunology 2020Quote: ... One microgram (1ug) of PCR was digested with 1ul of EcoR I-HF (New England Biolabs) and 1ul Hind III-HF (New England Biolabs ...
-
bioRxiv - Genomics 2021Quote: ... and the purified DNA was amplified using NEBNext® High-Fidelity 2X PCR Master Mix (NEB) with 10 cycles of PCR ...
-
bioRxiv - Genomics 2021Quote: ... previously purified ATAC-DNA was amplified using NEBNext® High-Fidelity 2X PCR Master Mix (NEB) with 10 cycles of PCR ...
-
bioRxiv - Cell Biology 2019Quote: ... The digested PCR products and CIP-treated vectors were ligated with T4 DNA ligase (M0202, NEB) at 16°C on a PCR machine overnight ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Typically, pL0s were generated via PCR (Q5 and OneTaq hot-start polymerases, New England BioLabs (NEB)) followed by In-Fusion (Takara Bio ...
-
Psi promotes Drosophila wing growth through transcriptional repression of key developmental networksbioRxiv - Developmental Biology 2020Quote: ... DNA fragments were enriched by PCR using NEB Next Ultra II Q5 Master Mix (NEB M0544S), before final clean up using Sera-Mag beads ...
-
bioRxiv - Microbiology 2020Quote: ... The wild-type Chlamydia trachomatis ct276 gene was amplified by PCR with Phusion DNA polymerase (NEB) using 100 ng C ...
-
bioRxiv - Microbiology 2022Quote: ... This PCR product was assembled with EcoRV linearized pLJM1entr using HiFi DNA Assembly (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: Phusion polymerase (Thermo) was used for PCR using primers from Microsynth (Switzerland) and restriction enzymes (NEB) for digestion ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions targeting the 3CLpro gene were performed using Q5® High-Fidelity DNA Polymerase (NEB) and the resulting PCR products were mixed and matched to recombine SARSCoV-2 3CLproL50F ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was performed according the to the manufacturer’s protocol using Phusion DNA Polymerase (New England Biolabs). DNA fragments were purified using the GeneJET Gel Extraction Kit (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR fragment being then re-circularized via NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). The various msrDL mutants were cloned via quickchange mutagenesis by amplifying pMMB-msrDL-msrD(1-3):yfp with primers 36 to 51 ...
-
bioRxiv - Microbiology 2022Quote: ... PCR fragment being then re-circularized via NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). Recoded sequence without the 7A codon (ATGTACCTGATCTTCATGTAA ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was then amplified using NEBNext High Fidelity PCR Master Mix (M0541S, New England Biolabs Inc.) and barcoded primers (see table MMX) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 200 ng of the purified PCR product was digested with T7 endonuclease I (New England BioLabs) as specified by the manufacturer ...
-
bioRxiv - Biochemistry 2022Quote: ... Mutant constructs were created and amplified via PCR with Q5® High-Fidelity DNA Polymerase (NEB), and the respective primers provided by NEBaseChanger (Synbio Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... and the PCR product was ligated into the plasmid using T4 DNA ligase (New England Biolabs), which yield pDRF1-GW AKAR3-EV.
-
bioRxiv - Evolutionary Biology 2022Quote: ... Fragments were amplified from the UCA860 sequence via PCR using Q5 Polymerase (NEB, Ipswich, MA, #M0491). The resulting fragments were purified using a 2X ratio of Aline beads (Aline Biosciences ...
-
bioRxiv - Evolutionary Biology 2022Quote: All cassettes were designed and prepared by fusion PCR approach using Phusion polymerase (NEB Biolabs, M0530S) as described elsewhere (Faktorová et al. ...
-
bioRxiv - Evolutionary Biology 2022Quote: All cassettes were designed and prepared by fusion PCR approach using Phusion polymerase (NEB Biolabs, M0530S) as described elsewhere (Faktorová et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... pENTR_proMpTIR1 and the 3xFLAG-AtTIR1 PCR products were digested with AscI (New England Biolabs, Massachusetts, U.S.A.) and then ligated into pENTR_proMpTIR1 to generate pENTR_proMpTIR1:3xFLAG-AtTIR1 ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions (50 µl) contained 1.0 unit of Phusion DNA polymerase (New England Biolabs catalog # M0419), 1 × Phusion HF buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The target gene sequences were PCR amplified from the purchased plasmids using either Phusion (NEB, M0531S) or Q5 High Fidelity (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... and PCR enrichment (eight cycles) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, Ipswich, MA). DNA concentrations were estimated using qPCR and the Kapa Library Quantitation Assay for Illumina (Kapa Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... and 200 bp downstream of marR were PCR amplified using Q5 DNA Polymerase (New England Biolabs) and cloned into the DraI and HindIII sites of the integrative vector pMV306 (67) ...
-
bioRxiv - Plant Biology 2022Quote: ... The specific cDNA was amplified by PCR using Phusion DNA polymerase (New England Biolabs, Ipswich, MA) and primers AtINOcDNA-f and AtINOcDNA-r (Supplemental Table S1) ...