Labshake search
Citations for New England Biolabs :
301 - 350 of 1210 citations for Sulfur Free Cobalt Metallo Organic Standard Co @ 5000 µg g in Hydrocarbon Oil since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 12.5 µl of OneTaq Quick-Load 2X Master Mix with Standard Buffer (New England Biolabs), 2 µl of diluted (1:10 ...
-
bioRxiv - Plant Biology 2023Quote: Each PCR consisted of 2.5 µL 10X Standard Taq Reaction Buffer (NEB, Ipswich, MA, USA), 0.5 µL 10 mM dNTPs (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... following the standard IVT protocol and purified using Monarch® RNA Cleanup columns (NEB # T2030).
-
bioRxiv - Biochemistry 2023Quote: ... Plasmids were constructed using either standard restriction cloning or HiFi DNA assembly (New England Biolabs) and propagated in DH5α E ...
-
bioRxiv - Cell Biology 2023Quote: All constructs were generated by standard cloning or by Gibson Assembly (NEBuilder HiFi Assembly, NEB) using XL10-Gold bacteria (Agilent) ...
-
bioRxiv - Plant Biology 2023Quote: ... Taq DNA polymerase (1.75 units) with standard Taq buffer (New England Biolabs, Pickering ON, Canada), 0.2 mM dNTPs and 0.2 μM primers (Table 1) ...
-
bioRxiv - Microbiology 2024Quote: ... Samples and standards were then amplified using the Luna 4x UDG system (NEB, Ipswich, MA) and the following primer set (Forward ...
-
bioRxiv - Microbiology 2024Quote: ... Peaks were identified by comparison to a standard 100 bp dsDNA ladder (New England Biolabs) that were fit to an exponential function of molecular weight versus distance.
-
bioRxiv - Cancer Biology 2024Quote: ... and PCR was performed with OneTaq Standard 5X buffer and OneTaq Polymerase (New England Biolabs) using a 96-well Thermal Cycler (ThermoFisher) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... using either standard restriction digestion and ligation or the Gibson Assembly procedure (New England Biolabs). Mutations were added to proteins using either the QuickChange II site-directed-mutagenesis kit (Agilent ...
-
bioRxiv - Biochemistry 2024Quote: ... The molecular weight standard used was the Quick-Load Purple 100 bp DNA Ladder (NEB). The PCR product band corresponding to the expected molecular weight of the RT-PCR product of the intron reverse spliced into the plasmid was excised from the gel ...
-
bioRxiv - Developmental Biology 2024Quote: We used standard molecular biology techniques and Gibson assembly (NEBuilder HiFi DNA Assembly; NEB #E2621) to assemble the constructs used in this study ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA was treated with RNase-Free DNase (New England Biolabs) and reverse-transcribed following manufacturer’s recommendations (The ProtoScript Taq RT-PCR Kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... or DNase I (RNase-free, New England Biolabs, Inc, MA), followed by phenol extraction ...
-
bioRxiv - Bioengineering 2024Quote: ... 0.3 U/µL glycerol-free WarmStart RTx (NEB #M0439B-HC1), 1X Chai Green (Chai Biosciences #R01200) ...
-
bioRxiv - Bioengineering 2024Quote: ... The LunaScript Primer-Free RT Master Mix Kit (NEB E3025S) was used to generate cDNA per manufacturer protocol ...
-
bioRxiv - Genomics 2023Quote: ... followed by RQ1 RNase-free DNase (NEB, Ipswich, MA, USA) treatment using manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... RNA extraction followed by a RNase-free DNase I (NEB.) and a S1 nuclease (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... and treated with RNAse-free DNAse I (New England Biolabs) to remove traces of the plasmid DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies used in this study were: anti-GFP from rabbit (1:5000, Torrey Pine Biolabs), anti-Myc 9E10 from mouse (1:2000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µg BSA dealt as negative control (NEB, Ipswich, MA, USA). Samples were applied in a final volume of 100 µl coating buffer (100 mM Tris-HCL pH 8 ...
-
bioRxiv - Developmental Biology 2022Quote: ... in HBSS supplemented with 10 µg/ml DNase (New England Biolabs) at 37°C and swirled at 100 rpm for 32 minutes to enzymatically separate the epithelium from the mesenchyme as we previously did [47] ...
-
bioRxiv - Physiology 2022Quote: ... 1.4 µg of H3-H4 (catalog no. M2509S, New England Biolabs) or H2A-H2B (catalog no ...
-
bioRxiv - Molecular Biology 2021Quote: ... The protein was then digested with LysC endoproteinase (0.25 µg; NEB) for 4 hours at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Nb35–His (10 µg/ml) and apyrase (25 mU/ml, NEB). The suspension was incubated for 1 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg BSA and 3 units of T4 DNA polymerase (NEB) and incubated at 20 °C for 30 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.5% SDS) with 10 µg proteinase K (New England Biolabs, P8107S), vortexed briefly ...
-
bioRxiv - Immunology 2024Quote: ... and 2 µg/µL of Proteinase K (New England Biolabs, #P8107S), was prepared and loaded into a 3 mL syringe (BD Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... plasmid DNA (2 µg) was digested with BsmBI-v2 (NEB, R0739) at 55°C for 3 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µg of pUPRT plasmid was linearised with AgeI-HF (NEB) (GRA59 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 200 µg/ml RNAse A (New England Biolabs #T3018-1)) for four hours on ice ...
-
bioRxiv - Molecular Biology 2023Quote: ... or RNase A (2 µg, Monarch RNase A; New England Biolabs) and incubating for another 15 min at 25°C ...
-
bioRxiv - Biophysics 2024Quote: ... and digested with 0.1 − 0.4U/µg BglI (New England Biolabs, R0143) to excise the insert from the backbone ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 µg of the final plasmid was cut with EcoRI (NEB), ethanol precipitated ...
-
bioRxiv - Bioengineering 2024Quote: ... and 1 µg of gDNA per sample was DpnI-digested (NEB) to remove residual donor plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... and pBluescript-hsp70l:loxp-STOP-loxp-EphB4aEE-p2A-Venus-cryaa-cerulean were co-injected with I-SceI (NEB) into the one-cell stage of embryos under the AB genetic background for transgenesis ...
-
bioRxiv - Plant Biology 2023Quote: Sequence-verified constructs were co-expressed with CyDisCo in SHuffle T7 Express C3029 (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Plant Biology 2023Quote: Sequence-verified constructs were co-expressed with CyDisCo in SHuffle T7 Express C3029 (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)A RNA (GpppA) (NEB, # S1406S) and G(5′)ppp(5′)G RNA (GpppG ...
-
bioRxiv - Molecular Biology 2020Quote: ... A slurry of protein A or G magnetic beads (NEB) was used to capture enriched chromatin ...
-
bioRxiv - Cell Biology 2020Quote: ... 75 µl of protein G magnetic bead suspension (S1430, NEB) pre-equilibrated in lysis buffer was added to each tube and incubation continued for additional 1 h at +4□C ...
-
bioRxiv - Microbiology 2024Quote: ... 50 μL of protein G beads (New England Biolabs (NEB), S1430S ...
-
bioRxiv - Microbiology 2024Quote: ... 50 μL of protein G beads (New England Biolabs (NEB), S1430S ...
-
bioRxiv - Biochemistry 2024Quote: ... and m7G(5′)ppp(5′)G capped (New England Biolabs) RP51A pre-mRNA substrates were made by in vitro transcription of a linear DNA template with T7 RNA polymerase (Agilent or purified in the laboratory) ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed with OneTaq Quick-Load 2x Master Mix with Standard Buffer (New England Biolabs). PCR product was run on an agarose gel and genotype was determined on size (168bp ...
-
bioRxiv - Molecular Biology 2021Quote: ... mutation of SSL2 (ssl2*) was accomplished by standard PCR reactions using Taq polymerase (New England Biolabs). ssl2* PCR products were then transformed into yeast along with a linearized pRS315 SSL2 LEU2 plasmid with most of the wild-type SSL2 sequence removed by restriction digest ...
-
bioRxiv - Genomics 2021Quote: A standard 28 base methylated hairpin oligonucleotide (CTGCCAGGATCTTTTTTGATCCTGGCAG) is provided by the manufacturer (New England Biolabs) at 15 µM ...
-
bioRxiv - Zoology 2021Quote: ... Reactions contained a final concentration of 1x Standard Taq Reaction Buffer (New England Biolabs, Massachusetts, USA), 2.5 mM MgCl2 ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR amplifications were conducted using Taq DNA Polymerase with Standard Taq buffer (New England Biolabs). The nucleotide sequences for RT-PCR and real-time PCR primers (synthesized by Sigma-Aldrich ...
-
Uptake of monoaromatic hydrocarbons during biodegradation by FadL channel-mediated lateral diffusionbioRxiv - Microbiology 2020Quote: All mutants were obtained via standard site-directed mutagenesis using the Q5 system (New England Biolabs), according to manufacturer specifications ...