Labshake search
Citations for New England Biolabs :
251 - 300 of 9943 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The second strand synthesis kit (NEB) at 16°C for 2 hours was used for cDNA synthesis followed by a 1.4X AMPure XP bead cleanup ...
-
bioRxiv - Cell Biology 2022Quote: ... Q5 site directed mutagenesis kit (NEB) was used and the manufacturer’s instructions were followed.
-
bioRxiv - Biophysics 2020Quote: ... and Q5 Hotstart Mutatagenesis kit (NEB) were used.
-
bioRxiv - Genomics 2022Quote: Monarch Genomic DNA Purification kit (NEB)
-
bioRxiv - Developmental Biology 2022Quote: ... “Q5 Site-Directed Mutagenesis Kit” (NEB) was used ...
-
bioRxiv - Neuroscience 2020Quote: ... using the Gibson assembly kit (NEB) to create pBPGUw-QF2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... HiScribe T7 ARCA mRNA kit (NEB) was used for mRNA synthesis with 10 μl of 2x ARCA/NTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... or Monarch RNA isolation kit (NEB) was used for RNA extraction ...
-
bioRxiv - Immunology 2021Quote: ... end blunting (Quick blunting kit; NEB), and ligation with (T4 ligase ...
-
bioRxiv - Neuroscience 2021Quote: ... NEBNext rRNA Depletion Kit (NEB E6310) was used ...
-
bioRxiv - Molecular Biology 2022Quote: ... Monarch RNA cleanup kit (T2030L, NEB), Murine RNase inhibitor (M0314L ...
-
bioRxiv - Biophysics 2022Quote: ... using a Gibson Assembly kit (NEB). Full-length Cav1.2 or Cav1.2(ΔC ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted by NEB PCR Cleanup Kit (NEB Cat. # T1030), followed by quality control steps using Qubit fluorometer and bioanalyzer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The NEBNext Library Quant kit (NEB) was used to quantify the amplicons prior to pooling ...
-
bioRxiv - Cancer Biology 2022Quote: ... Using LunaScript RT Supermix kit (BioLabs), cDNA was prepared in a 20 μL reaction according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The Monarch RNA Cleanup Kit (NEB) was used to purify the resulting RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Q5 site directed mutagenesis kit (NEB) was used to generate various SARS-CoV-2 FSE conformation stabilizing constructs and other length dependent constructs and their sequences were confirmed through sanger sequencing (Eurofins genomics) ...
-
bioRxiv - Cell Biology 2024Quote: ... using the HiFi Assembly kit (NEB). NEBuilder Assembly Tool 2.0 was used to design RRM1-2 primers with 21-bp overlap with the destination vector ...
-
bioRxiv - Immunology 2024Quote: ... The NEBNextII kit (New England Biolabs) was used to prepare the sequencing library ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Q5 Site-Directed Mutagenesis Kit (NEB) was used according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: Site-Directed Mutagenesis Kit (NEB E0554). Following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... Monarch® RNA Cleanup Kit (NEB) was used to purify RNAs ...
-
bioRxiv - Synthetic Biology 2023Quote: Monarch DNA Gel Extraction kit (NEB), for purifying PCR products products prior to assembly (Note ...
-
bioRxiv - Molecular Biology 2023Quote: ... The NEBNext rRNA depletion kit (NEB) was used to deplete ribosomal RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Monarch RNA Cleanup kit (T2030L, NEB), Murine RNase inhibitor (M0314 ...
-
bioRxiv - Biochemistry 2024Quote: ... the HiFi Assembly Kit (NEB, #E2621) was utilized.
-
bioRxiv - Microbiology 2024Quote: ... Three different reverse transcriptase kits (NEB LunaScript Multiplex One-Step RT-PCR Kit (Cat no ...
-
bioRxiv - Systems Biology 2024Quote: ... and gel purified (NEB Monarch Kit). Note pMVS219 and pMVS142 have the same sequence ...
-
bioRxiv - Microbiology 2024Quote: ... using Gibson assembly Cloning kit (NEB). The Gibson assembly constructs were transformed into E ...
-
bioRxiv - Biochemistry 2024Quote: ... PURExpress D Ribosome Kit (NEB #E3313S) and New England Biolabs PURExpress In Vitro Protein Synthesis Kit (NEB #E6800) ...
-
bioRxiv - Biochemistry 2024Quote: ... The Monarch Plasmid Miniprep kit (NEB) was used to isolate DNA plasmids ...
-
bioRxiv - Genetics 2024Quote: ... or HiFi assembly kit (NEB, E5520S). For construction of AAV-U6gRNA-5HA-2xHA-3HA ...
-
bioRxiv - Biophysics 2021Quote: The DNA substrate used in the optical trapping assay was a ~3400-bp PCR-amplified section of plasmid PBR322 (New England Biolabs). The forward primer (5’-/btn/-ACA GCA TCG CCA GTC ACT AT-3’ ...
-
bioRxiv - Biophysics 2021Quote: The assembly of GRB2 SH3 and PSD95 PDZ mutant libraries in both assay plasmids were done overnight by temperature-cycle ligation using T4 ligase (New England Biolabs) according to the manufacturer's protocol ...
-
bioRxiv - Genetics 2021Quote: ... The mutagenesis of target sites was confirmed in a subset of somatic mosaics using a T7 endonuclease assay (NEB, UK).
-
bioRxiv - Molecular Biology 2021Quote: LAMP assay was performed in a total volume of 25 μl with Bst 2.0 WarmStart™ DNA Polymerase (New England Biolabs). The reagents ...
-
bioRxiv - Immunology 2021Quote: The DNA sequences of B.1.351 and B.1.617 SARS-CoV-2 spikes for the mRNA transcription and pseudovirus assay were synthesized as gBlocks (IDT) and cloned by Gibson Assembly (NEB) into pcDNA3.1 plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... The subsequent CRISPR detection was performed by adding 8.75 μL of CRISPR Mix (1X TtCmr Activity Assay Buffer, ~62.5 nM TtCmr complex, 500 nM TTHB144, 2 μL NTP Buffer Mix (NEB #E2050), 25 U Hi-T7 RNA polymerase (NEB #M0658) ...
-
bioRxiv - Neuroscience 2022Quote: ... were designed using the CCTop target online predictor (Stemmer et al, 2015) and cutting efficiency was evaluated by T7EI Assay using T7 Endonuclease I (NEB). We selected the TSC2Ex2-gRNA (TGTTGGGATTGGGAACATCGAGG ...
-
bioRxiv - Bioengineering 2022Quote: ... In vitro Cas9 cleavage assay was carried out using purified IVT product and Cas9 protein (Cas9 Nuclease, S. pyogenes, New England BioLabs) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... integrated HIV DNA and unspliced HIV RNA was performed by modified nested real-time PCR assay using Taq DNA polymerase (BioLabs) in the first PCR and TaqMax Fast Advanced Master Mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... Equal volumes of each immunoprecipitated sample were then aliquoted into two tubes and beads were then resuspended with 100 microliters of lambda phosphatase assay buffer containing 400 units of lambda protein phosphatase (NEB), or with 100 microliters of lambda phosphatase assay buffer alone ...
-
bioRxiv - Cancer Biology 2022Quote: ... OFP positive bulk populations were single-cell cloned in 96-well plates and a total of 12 clones screened for mismatches by T7E1 assay (New England Biolabs). Briefly ...
-
bioRxiv - Genetics 2022Quote: ... The promoter was then amplified from the construct prepared for the retrotransposition assay using Q5 High-Fidelity 2x Master Mix (New England Biolabs). Primers and annealing temperatures are listed in Supplemental Table 1 ...
-
bioRxiv - Plant Biology 2020Quote: Recombination assays were performed with single-strand linear ΦX174 virion DNA and double strand circular ΦX174 RFI DNA (New England Biolabs) linearized with PstI in 20 mM Tris-acetate pH 7.4 ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins from the supernatant at 2 mg/mL were used for the Co-IP assay using Protein G magnetic beads (New England Biolabs) and a mouse monoclonal anti-HA antibody (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR amplification products of the mutation site were used in restriction fragment length polymorphism assays with the AluI restriction enzyme (NEB) to screen for possible edited clones ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve cDNAs were then serially diluted ten-fold from 10-1 to 10-8 and run through the SYBR Green assay (New England Biolabs) together with sample cDNAs ...
-
bioRxiv - Biochemistry 2023Quote: Between 1e9 and 1e10 vg were used as input material to bind to different magnetic beads for pulldown assays: SNAP-Capture Magnetic Beads (NEB) for SNAP tag insertion ...
-
bioRxiv - Genomics 2023Quote: ... The polymerase employed in our qPCR stop assays was exonuclease and proof-reading activity deficient Klenow fragment (M0212L; New England Biolabs). The Control DNA (Fig 3A ...