Labshake search
Citations for New England Biolabs :
301 - 350 of 9943 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... we quantitated the proportion of abnormal DNA fragments generated by the procedure using DNA prepared from the transfected cell population and a polymerase chain reaction (PCR)-based T7 endonuclease assay (New England BioLabs). The PCR was performed with primers flanking the predicted ligation-junction product (forward primer AGAATACCAGGGGGCCATGA and reverse primer AACGAATCCTTTCCCTGGGTC) ...
-
bioRxiv - Biophysics 2023Quote: Oligonucleotides used as substrates in D-loop assays were radiolabelled at their 5′-end using T4 Polynucleotide Kinase (T4 PNK - NEB) and adenosine triphosphate [γ-32P] (Perkin Elmer ...
-
bioRxiv - Neuroscience 2024Quote: ... in a black-bottomed 96-well plate and gene-specific LA qPCR assays were performed as described earlier20 using Long Amp Taq DNA Polymerase (New England BioLabs).
-
bioRxiv - Neuroscience 2024Quote: ... in a black-bottomed 96-well plate and gene-specific LA qPCR assays were performed as described earlier (35) using Long Amp Taq DNA Polymerase (New England Biolabs). POLB and RNAPII (12.1 and 11.3 kb ...
-
bioRxiv - Microbiology 2024Quote: ... DNA constructs for single-molecule magnetic trapping assay were prepared by digesting the obtained plasmids with XbaI and SbfI (New England Biolabs), and then ligated with two 1-kb DNA fragments modified with multiple biotin groups and digoxigenin groups through the XbaI and SbfI sites61 ...
-
bioRxiv - Biophysics 2024Quote: In vitro crRNA processing and tgRNA cleavage assays were performed in 10 µL reactions with the following final concentrations: 40 U Murine RNase Inhibitor (NEB), and 6 mM MgCl2 ...
-
bioRxiv - Biophysics 2024Quote: ... Assembly quality was determined by running an electrophoretic mobility shift assay on mononucleosomes formed from digesting dodecameric arrays by EcoRI-HF (NEB)38,39.
-
bioRxiv - Cell Biology 2024Quote: ... Eluted protein was detected via Bradford assay and immediately applied to a 1 mL amylose column at 4°C (New England Biolabs) at 10-15 ml/hr that was pre-equilibrated with nickel elution buffer ...
-
bioRxiv - Microbiology 2023Quote: ... using the kit Luna® Universal qPCR Master Mix Kit (New England Biolabs, Ipswich, MA, United States). PCRs were conducted in a total volume of 20 µl containing 10 μL of Luna Universal qPCR Mix ...
-
bioRxiv - Microbiology 2021Quote: All PCR assays were carried out in 25 μL total reaction volumes using 2x Mastermix (New England Biolabs Inc., Ipswich, USA), 1.25 μL oligonucleotide primes (10 μM ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA template for the assay was generated by annealing a primer (5′-CCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded DNA (New England Biolabs, N4040S). The assay was initiated by incubation of 1nM of DNA template with 1 mM ATP ...
-
bioRxiv - Genomics 2022Quote: ... The DNA substrates for in vitro cleavage assays were synthesized using Phusion® Hot Start Flex 2X Master Mix (NEB, M0536S) and purified using GeneJET PCR Purification Kit (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... 89 bp segment surrounding the lesion site. PCR product was processed using T7 endonuclease assay (Fig. S6) per manufacturers instruction (NEB #E3321) to identify retwmr1/+ embryos which were then pooled and processed via previously described HCR and whole-mount immunohistochemical preparations ...
-
bioRxiv - Cell Biology 2023Quote: ... Extracted genome DNA was used to amplify the surrounding region of the m.15059G>A mutation for T7 Endonuclease I (T7EI) mismatch detection assay using Q5 Hot Start High-Fidelity 2X Master Mix (New England BioLabs, USA) in accordance with recent studies 27 ...
-
Adaptation of CD4 in gorillas and chimpanzees conveyed resistance to simian immunodeficiency virusesbioRxiv - Microbiology 2024Quote: ... Whole-cell extracts were quantified using the BCA assay and 10 µg was subjected to PNGase F (New England Biolabs, #P0705S) treatment according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Immunoblot assay with the anti-Flag antibody was conducted to assess the expression of Cas9 and T7 endonuclease I-cutting assay (NEB, M0302S) was used to examine the activity of spCas9 in the isolated clones ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were then purified using the DNA cleanup column kit (the Monarch PCR & DNA cleanup kit from NEB).
-
bioRxiv - Biochemistry 2020Quote: ... Samples were then purified using the DNA cleanup column kit (the Monarch PCR & DNA cleanup kit from NEB). The specificity of AlkB repair reaction was confirmed using an inactive AlkB control reaction in which Fe2+ ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... or FLAG (amino acid sequence: DYKDDDDK) with a kit (Gibson assembly kit from New England Biolabs, catalogue # E5510S). The different combinations were cloned into pJFRC7-20XUAS-IVS-mCD8::GFP (Addgene # 26220 ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the NEBNext Ultra DNA Library Prep Kit (kit number E7370L, New England Biolabs) and 8 cycles of PCR ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was isolated from blood (QiaAmp DNA Mini Blood Kit, Qiagen; or Monarch Genomic DNA purification kit, NEB) or from perfused organs homogenized (Fisher Bead Mill 4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... NEB One Taq RT-PCR kit (One Taq® RT-PCR Kit, New England Biolabs INC, Frankfurt, Germany) was used for cDNA synthesis ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Dephosphorylated mRNA was then purified using RNeasy Mini Kit or Monarch RNA Cleanup Kit (New England Biolabs Japan). The concentration of purified mRNAs was measured using Qubit RNA Broad Range Assay Kit and Qubit 4 Fluorometer ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was isolated using the RNA extraction kit (Monarch Total RNA Miniprep Kit, New England Biolabs, Cat# T2010S). 500ng of RNA was reverse transcribed using the reverse transcription kit (iScript cDNA synthesis kit ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sequencing libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina kit (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or Monarch PCR & DNA Cleanup Kit (NEB) according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: NEBNext rRNA Depletion Kit (NEB, Cat E6310S) was used to deplete ribosomal RNA according to the manufacture’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... The HiScribe Quick T7 kit (NEB, E2050S) was then used for in vitro transcription ...
-
bioRxiv - Molecular Biology 2020Quote: ... a quick ligation kit (New England Biolabs) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... Q5 Site-Directed Mutagenesis Kit (NEB E0554S) and restriction cloning were used to generate partial constructs ...
-
bioRxiv - Molecular Biology 2020Quote: ... Phusion high fidelity DNA polymerase kit (NEB) was used for the PCR amplification and optimized with DMSO and formamide ...
-
bioRxiv - Physiology 2021Quote: ... and Monarch PCR Cleanup Kit (NEB, T1030). PCR products were electrophoresed in 2% agarose gel (TopVision Agarose Tablets ThermoFisher R2801 ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Gibson Assembly kit (NEB#E2611). To verify the identity and relative representation of sgRNAs in the pooled plasmids ...
-
bioRxiv - Cancer Biology 2020Quote: The Q5 Site-Directed Mutagenesis Kit (NEB) was used according to the manufacturer’s instructions to either delete the peak5 conserved 192 base pair sequence or mutate SoxE binding sites ...
-
bioRxiv - Molecular Biology 2020Quote: ... using Quick Ligation Kit (New England Biolabs). Positive pSpCas9(BB)-gRNA clones were confirmed by Sanger sequencing and expanded using PureLink® HiPure Plasmid Midiprep Kit (Invitrogen).
-
bioRxiv - Synthetic Biology 2021Quote: ... and Monarch PCR & DNA Cleanup Kit (NEB) were used in this study for DNA purification.
-
bioRxiv - Microbiology 2020Quote: ... using a Gibson Assembly Cloning Kit (NEB). Primers were designed to introduce a thrombin site between the P113 gene fragment and the coding sequence for Cd4-His6 on the P113-bio vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 μl Murine RNase Inhibitor (NEB-kit) and 0.5 μl ProtoScript II RT (NEB-kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was capped Vaccinia capping kit (NEB) and recovered using Directzol RNA mini prep kit (Zymo research).
-
bioRxiv - Cell Biology 2022Quote: ... using the Gibson Assembly Cloning Kit (NEB). HeLa cells were cotransfected using XtremeGENE 9™ (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... the NEB Ultra II FS kit (NEB #E6177L ...
-
bioRxiv - Developmental Biology 2020Quote: ... using NEB Quick Ligation Kit (NEB, M2200S).
-
CRISPR-Cas9-mediated knockout of CYP79D1 and CYP79D2 in cassava attenuates toxic cyanogen productionbioRxiv - Plant Biology 2021Quote: ... the Monarch PCR & DNA Cleanup Kit (NEB), or SPRI magnetic nucleic acid purification beads (UC Berkeley DNA Sequencing Facility) ...
-
bioRxiv - Neuroscience 2020Quote: Illumina compatible libraries were made from Visium derived cDNA using a modified protocol derived from NEB Ultra II DNA FS kit (NEB #E6177). Visium derived spatial cDNA was diluted to 100ng in 26μl and combined with 7μl NEBNext Ultra II FS Reaction Buffer and 2μl NEBNext Ultra II FS Enzyme Mix and incubated at 37°C for 15min ...
-
bioRxiv - Molecular Biology 2022Quote: ... or Q5-Site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... using the NEBuilder kit (New England Biolabs). We submitted transgenic constructs to The BestGene Inc ...
-
bioRxiv - Immunology 2020Quote: ... 1c using Gibson assembly kit (NEB, #E2611S). To promote the targeting efficiency ...
-
bioRxiv - Microbiology 2020Quote: Libraries were mini-prepped (NEB Monarch Kit) and electroporated into the SEER chassis with more than 1,000-fold coverage ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Q5 mutagenesis kit (NEB, Cat: E0554) was used to generate the mutant plasmids ...