Labshake search
Citations for New England Biolabs :
2801 - 2850 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... The clones were then screened by PCR (Q5-NEB) and amplified to be further analysed by western blot.
-
bioRxiv - Cancer Biology 2021Quote: ... The radiolabeled PCR product was digested with PstI (NEB) for 2 hrs at 37 °C to distinguish PKM1 (undigested ...
-
bioRxiv - Molecular Biology 2021Quote: ... purified with the Monarch PCR & DNA Cleanup Kit (NEB) and ligated with T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product was digested with Kpn I (NEB) and Hind III (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... All PCRs were performed using Phusion DNA polymerase (NEB). Molecular cloning was performed using HiFi DNA Assembly (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR reactions utilizing Q5 (New England Biolabs cat # M0492L), a high-fidelity DNA polymerase ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was PCR amplified using NEBNext High-Fidelity (NEB, M0541 ...
-
bioRxiv - Immunology 2022Quote: ... The targeted gene region was amplified by PCR (NEB Next High-Fidelity 2xPCR Master Mix ...
-
bioRxiv - Microbiology 2022Quote: ... PCRs were performed using Q5 DNA polymerase kit (NEB) with the appropriate primer pair and 25 ng of plasmid as template (segment 1 of PR8 ...
-
bioRxiv - Microbiology 2022Quote: ... PCRs were performed using Q5 DNA polymerase kit (NEB) with the appropriate primer pair and 25 ng of plasmid as template (Seg1-PR8 or Seg5-PR8) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were cleaned using Exo-CIP™ (NEB) and sequenced on an ABI 8730XL with BigDye Taq FS Terminator V3.1 (University of Pennsylvania ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR products were circularized via ligation (New England Biolabs). For Melt-effector fusions ...
-
bioRxiv - Genomics 2023Quote: ... Amplicons were purified with the Monarch PCR kit (NEB), digested with MfeI-HF and SphI-HF (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... After 5 PCR cycles using Q5 polymerase (NEB #M0491) with 5X GC Buffer with a melting temperature of 72°C ...
-
bioRxiv - Biochemistry 2024Quote: ... and purified with Monarch PCR & DNA cleanup kit (NEB). PURExpress in vitro translation reaction was assembled in RNase-free tubes according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The oligo was obtained from IDT DNA and amplified by PCR using Phusion Polymerase (NEB F630) and purified for in vitro transcription using the MEGAshortscript T7 kit (Invitrogen AM1333) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purification with a PCR clean-up kit (NEB) following the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR product was digested by EagI (New England Biolabs) and ligated into FMR1 RNA construct backbone instead of 5’UTR of FMR1 sequence using T4 ligase (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... we amplified the targeted gene regions by PCR (NEB Next High-Fidelity 2xPCR Master Mix ...
-
bioRxiv - Biophysics 2024Quote: ... and Monarch PCR&DNA Cleanup Kit (5 μg) (NEB). The purified dsDNA templates were transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... PCRs were performed using the Q5 DNA polymerase (NEB) in a GeneAmp PCR system 2400 (Applied Biosystems).
-
bioRxiv - Cell Biology 2024Quote: ... PCR amplicons were subsequently ligated using T4 ligase (NEB) in a reaction with DpnI (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting PCR product was treated with DpnI (NEB), gel purified using GeneJET Gel Extraction and DNA Cleanup Micro Kit (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR product was cloned with BamHI (R0136S, NEB), NheI (R3131S ...
-
bioRxiv - Developmental Biology 2024Quote: ... Reactions were purified with a PCR purification kit (NEB). Approximately 120–150 ng of DNA was used as a template for a T7 in vitro transcription (IVT ...
-
bioRxiv - Genomics 2024Quote: ... and NEBNext High-Fidelity 2x PCR Master Mix (NEB) for 12 cycles to generate each library ...
-
bioRxiv - Biochemistry 2024Quote: ... A colony PCR using Taq Polymerase (New England Biolabs) on positive resistant colonies can help identifying false positives for Ampicillin resistance ...
-
bioRxiv - Bioengineering 2024Quote: ... Genotyping PCR was then conducted using Q5 polymerase (NEB) for genomic DNA and cDNA ...
-
bioRxiv - Bioengineering 2024Quote: ... primarily using PCRs (Q5 ultra II HotStart Polymerase, NEB), Gibson Assemblies (NEBuilder HiFi DNA Assembly Master Mix ...
-
bioRxiv - Systems Biology 2023Quote: ... gDNA was amplified by PCR with Phusion polymerase (NEB) using primers CAAGCAGAAGACGGCATACGAGAT -i7 - GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCACTGCTAGCTAGATGACTAAACGCG and AATGATACGGCGACCACCGAGATCTACAC - i5 - ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGGTCTGGATCCACCGGTCC ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were circularized with T4 kinase (NEB, M0201L) and T4 ligase (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Colony PCR reactions were performed with Taq polymerase (NEB). QiaQuick PCR purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μL NEBNext HiFi 2 × PCR Master mix (NEB) was added ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The PCR product was incubated with DpnI (NEB, USA) in 1 hour at 37°C to digest the template plasmid.
-
bioRxiv - Microbiology 2022Quote: ... whereas diagnostic PCR used standard Taq DNA polymerase (NEB).
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were purified by gel extraction (NEB, T1020) and sequenced on a NextSeq 500 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... PCR reactions were performed using Q5 DNA polymerase (NEB) or PrimeSTAR MAX (Takara) ...
-
bioRxiv - Microbiology 2023Quote: ... Diagnostic PCRs were performed with OneTaq DNA polymerase (NEB) or GoTaq DNA polymerase (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were purified by gel extraction (NEB, T1020) and sequenced on a NextSeq 500 (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... after PCR amplification and Gibson cloning (New England BioLabs). Constructs were confirmed by DNA sequencing and introduced into BL21 (DE3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCRs utilised Q5 High-Fidelity Master Mix (NEB) or Phusion High-Fidelity Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR reaction consisted of 1x ThermoPol Buffer (NEB), 200 µM dNTPs ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR was completed using 1x reaction buffer (NEB), 200 µM dNTPs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... indexing PCR was performed using Q5 (New England Biolabs) under the following conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... New vectors were generated by PCR (Phusion-HF, NEB) into parent vectors digested with FseI/AscI unless otherwise stated ...
-
bioRxiv - Cell Biology 2023Quote: ... PCRs were performed using Phusion polymerase (New England Biolabs). Details on primer sequences ...
-
bioRxiv - Biophysics 2023Quote: ... PCR products were digested with BamHI and NotI (NEB) and ligated into BamHI/NotI-digested pACYC-Duet-1 vector (Novagen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was performed with Taq polymerase (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... A Q5 high fidelity PCR reaction (New England Biolabs) was performed on the cDNA to amplify TsKSRP and TsAGO genes using primers encoding a c-myc tag at the 3’ end ...
-
Sphingosine induction of the Pseudomonas aeruginosa hemolytic phospholipase C/sphingomyelinase, PlcHbioRxiv - Microbiology 2023Quote: ... All PCRs were conducted using Q5 DNA polymerase (NEB). Primer sequences are listed in the supplemental data (DataSet1 ...