Labshake search
Citations for New England Biolabs :
2601 - 2650 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and a 1848 bp fragment (containing the 1131 bp Pfcytb open reading frame) was amplified with primers (SI Appendix, Fig. S2A,B) and Phusion DNA polymerase (NEB). PCR product was verified by gel electrophoresis as single band of predicted size ...
-
bioRxiv - Molecular Biology 2023Quote: ... Tagmented samples were amplified by the addition of 2.5 µL each of 10 µM barcoded forward and reverse primers (Picelli et al., 2014) (Picelli et al., 2014) and 15 µL Q5 2x HiFI MasterMix (New England Biolabs) using the following thermocycling conditions ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Evolutionary Biology 2023Quote: ... gigas β/δ82Asn→Lys Hb mutant via site-directed mutagenesis on the Steller’s sea cow Hb expression vector by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 mM each of forward and reverse primers (Supplemental Table 2) and 0.5 U Phusion® HF DNA polymerase (NEB) in a reaction volume of 25 μl ...
-
bioRxiv - Microbiology 2022Quote: ... we amplified the gene ctl0382 (homolog of ct127) with a six histidine tag in the reverse primer using Phusion enzyme (NEB), and the PCR product was linked with pBOMBL::L2 linearized by EagI and KpnI using HiFi assembly system (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: The V7 variant of AR was generated from peGFP-C1-AR using the Q5 site-directed mutagenesis kit and primer design tools (New England BioLabs) with the following primer pair:
-
bioRxiv - Microbiology 2023Quote: ... was constructed by PCR amplification of the mCTX2-PexoT-ZTP-lacZ plasmid using the three GA primer pairs (Table 1) followed by NEBuilder assembly (NEB). The resulting PexoT-ZTP(M4)-lacZ reporter fusion was integrated in the P ...
-
bioRxiv - Neuroscience 2023Quote: ... Adaptor ligated cDNA was PCR enriched to incorporate an Illumina compatible index sequence (NEBNext Multiplex Oligos for Illumina, Dual Index Primers Set1, E7600S, New England Biolabs). The libraries were purified using AmPure XP beads ...
-
bioRxiv - Microbiology 2023Quote: ... The DNA was amplified by performing a multiplexed PCR in two pools using the ARTIC-N6 primers and the Q5 High-Fidelity DNA polymerase or Q5 Hot Start DNA polymerase (New England BioLabs). The DNA libraries for Illumina NGS were prepared from pooled amplicons by using a QIAseq FX DNA Library Kit (QIAGEN ...
-
bioRxiv - Bioengineering 2023Quote: ... The β2-tubulin locus was amplified with the 1114A.S43 (5’ GAGAGCAACACTCGTGCG 3’) and 1114A.S44 (5’CAGGGTGGCATTGTACG 3’) primers and the amplicon was digested with Fspl (NEB cat#R0135S) or Ddel (NEB cat#R0175S ...
-
bioRxiv - Genetics 2023Quote: ... PCR primers were designed to specifically amplify the tandem duplication junctions for each family using Longamp Taq Polymerase (New England Biolabs), then Sanger sequenced (Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... in combination with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (Unique Dual Index Primer Pairs) (New England BioLabs). The resulting libraries were subjected to sequencing on a NextSeq 550 Sequencing System (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... Unincorporated primers were digested from the pre-amplified samples using 16 U/μl Exonuclease I (E. coli, New England Biolabs) at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sgRNA sequences were amplified from the genomic DNA with primers Illumina PCR1 FWD and Ilumina PCR1 REV using Phusion Hot Start Flex polymerase (New England Biolabs), with the annealing temperature set at 58°C ...
-
bioRxiv - Microbiology 2023Quote: ... PCRs were performed using specific reaction primer pairs specific to the appropriate parental segment (Table 3) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and primers listed in (Extended Data Table 3) and used for in vitro transcription by T7 RNA polymerase (New England Biolabs). Resulting RNA was purified using a spin-column kit (RNeasy mini kit ...
-
bioRxiv - Microbiology 2023Quote: ... Variants of the Bil system were generated by amplification of the plasmid containing the wild-type Bil system12 using primers that contained the desired modification followed by treatment with KLD enzyme mix (NEB) according to the manufacturer’s instructions to obtain transformable plasmids ...
-
bioRxiv - Microbiology 2023Quote: The cellular mRNA from THP-1 cells was reverse transcribed with oligo-dT primer through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs) after TRIzol (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... Amplification was performed following bisulfite conversion using primers from the NEBNext Multiplex Oligos for Illumina (cat#: E6440S, New England BioLabs) and the Kapa HiFi Uracil+ PCR system (cat# ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were amplified with 16 cycles of PCR using the NEBNext Ultra II Q5 Master Mix (provided) and unique index primer mixes from NEBNext Multiplex Oligos for Illumina Library (#E6609L, New England Biolabs). Libraries were purified with 0.9× SPRISelect Beads (#B23318 ...
-
bioRxiv - Immunology 2023Quote: ... The following primers were used to amplify the Mpro sequence from cDNA with the Phusion polymerase kit (New England BioLabs). F:AATAAGGTACCAGTGGTTTTAGAAAAATGG ...
-
bioRxiv - Biophysics 2022Quote: ... The HiBit-Hsp70 insert was PCR-amplified directly from pEGFP-Hsp70 plasmid using primers containing the HiBit sequence and then inserted using AgeI and XbaI (NEB), which is SpeI compatible ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... mel pse nos 3’ UTR transgenes were created by first isolating species specific nos 3’ UTR from genomic DNA using PCR with primers with EcoRI and XhoI cut sites engineered at the ends of the forward and reverse primers and amplified with Phusion DNA Polymerase (NEB). Primers were designed based on the D ...
-
bioRxiv - Genomics 2023Quote: ... was used to prepare libraries with the NEBNext Ultra II library preparation kit with unique dual index primers (New England Biolabs). The library quality and quantity were verified by BioAnalyzer DNA 1000 (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... derived from cloning with primers/restriction enzymes (Table S3) with standard cloning procedures (restriction enzymes and T4 DNA ligase from NEB) as described previously (57) ...
-
bioRxiv - Genomics 2023Quote: ... The two primer pools were used to generate tiled amplicons using Q5 high-fidelity 2X master mix (New England Biolabs), followed by a clean up step and quantification using the Qubit ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA resistant fragments, and pEM791 vector (Sturgill et al., 2016) were amplified with primers designed for Gibson Assembly (New England BioLabs) and subsequently assembled via Gibson Assembly ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3.1-FLAG-ZBTB48 WT was used as template for the generation of the constructs with point mutations in the C-terminal arm using the primers in Table S6 and the Q5 Site-Directed Mutagenesis Kit (NEB). In brief ...
-
bioRxiv - Biochemistry 2023Quote: Overexpression plasmids for the rescue of B3GALT5 and B3GNT5 KOs were generated by Gibson cloning using the primers listed below designed using the NEBuilder software from New England Biolabs (NEB) to amplify the open reading frame (ORF ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was pre-amplified with pooled barcoded primers before libraries were prepared with NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs) using the AMPure XP reagent (AgenCourt Bioscience ...
-
bioRxiv - Biophysics 2023Quote: ... and a reverse elongation primer (Supplementary Tables 1 and 2) and incubating for 1 cycle of annealing/extension with Q5 polymerase (New England Biolabs). dsDNA product was then incubated with ExoSAP-IT (Applied Biosystem ...
-
bioRxiv - Microbiology 2023Quote: ... was generated using primers 2238–2027 The RNAs were synthesized in 50 μl reactions containing T7 RNA polymerase (25 units; New England Biolabs), 40 mM Tris–HCl (pH 7.9) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.25 µM of forward and reverse primers mixed in a final volume of 25 µl reaction using Q5 Hot Start High-Fidelity 2X Master Mix (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Promoters and 3’ UTRs were amplified from Col-0 genomic DNA using the primers listed in (Supp Table 3) with Q5 Hot Start High-fidelity DNA polymerase (NEB). For MBD5 and SUVH3 ...
-
bioRxiv - Microbiology 2023Quote: ... the full-length 16S rDNA sequence amplified with primers 8F and 1522R (Turner et al., 1999) with High Fidelity Q5 Taq polymerase (NEB). A high-quality sequence was obtained by the Sanger method and was used to query the 16S rRNA BLAST database ...
-
bioRxiv - Genomics 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Genomics 2023Quote: ... cDNA libraries were amplified with 16 cycles of PCR using the NEBNext Ultra II Q5 Master Mix (provided) and unique index primer mixes from NEBNext Multiplex Oligos for Illumina Library (#E6609L, New England Biolabs). Libraries were purified with 0.9× SPRISelect Beads (#B23318 ...
-
bioRxiv - Cell Biology 2023Quote: ... BSP1 was amplified from genomic DNA with primers 5’-ctggaagttctgttccaggggcccatgacaaaatatgagcgtgaccctg and 5’-ccccagaacatcaggttaatggcgttacacgcgtgttggaagttttcttc while pCoofy3 was linearized with primers 5’-cgccattaacctgatgttctgggg and 5’-gggcccctggaacagaacttccag using Q5 High-Fidelity 2X Mastermix (New England Biolabs). After DNA fragments were purified from agarose gel ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 nM of RCA primer, 1U/µL of RiboProtect (Blirt, #RT35) and 0.5 U/ µL of T4 RNA Ligase 2 (NEB, # M0239L). The ligation mix was introduced to the SecureSeal chamber and incubated on the samples for 2 hours at 37 degrees Celsius ...
-
bioRxiv - Developmental Biology 2023Quote: The myo1g ORF was amplified from mixed stage pool of cDNAs using primers 5’-GATCCCATCGATTCGATGGCGGAGCTGGAGGGCTTG-3’ and 5’-AGGCTCGAGAGGCCTTACTGGGGCAGGAGTAAGG-3’ and cloned into the pCS2+ vector using Gibson assembly mix (NEB). Bold letters in the primer sequences indicate Gibson overhangs that are also present in the pCS2+ sequence ...
-
bioRxiv - Microbiology 2023Quote: ... HMBS_232 was cloned into pCMV-puroR lentiviral plasmid using the primers listed in Table S6 and NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs). Lentiviruses were produced as already mentioned ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-directed mutations were generated using specific primers for amplification with Phusion High-fidelity DNA polymerase (New England Biolabs, #M0530S), followed by template digestion with DpnI restriction enzyme (Takara ...
-
bioRxiv - Cell Biology 2024Quote: ... Size-selected DNA fragments were amplified using NEB unique multiplexed i5 and i7 primers (E6440) in a total reaction volume of 100 µl together with 2 U Phusion High-Fidelity DNA Polymerase (NEB) and in the presence of 0.2 mM dNTPs and 1X Phusion High-Fidelity buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... zact sequence was amplified with primers containing attB sites (F: GGGGACAAGTTTGTACAAAAAAGCAGGCTC-CATGGATGAGGAAATCGCTG; R: GGGGACCACTTTGTACA-AGAAAGCTGGGTAGAAGCACTTCCTGTGGACGATG) using a high-fidelity polymerase (Phusion, NEB). To create a middle entry clone pME-zact ...
-
bioRxiv - Genomics 2024Quote: ... The ATAC libraries were amplified for 11 cycles using NEBNext 2X MasterMix and Nextera Index primers (New England Biolabs, # M0541S). The amplified libraries were size selected using AMPure beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... and the colonies were screened for the insert of a right size with the primers pMRB-PlacGFP_ins_1_F and pMRB-PlacGFP_ins_1_R using Phusion polymerase (NEB, Phusion High Fidelity DNA Pol, M0530L) polymerase for the insert longer than 5kb (PCR thermocycling conditions were as follows ...
-
bioRxiv - Microbiology 2024Quote: ... The colonies were screened for insert using Check1_ins_pSW_for and Check1_ins_pSW_rev primers from Supplementary Data 7 using Phusion polymerase (NEB, Phusion High Fidelity DNA Pol, M0530L) polymerase for inserts >5kb (PCR thermocycling conditions were as follows ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 400 ng of modified or control RNA was incubated with of 200 ng/µL random nonamer primer (NEB; S1254S) and 1.0 µL of POWV_SHAPEMAP_RT_Primer (Supplemental Table S2 ...