Labshake search
Citations for New England Biolabs :
2651 - 2700 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... The NEBuilder Assembly Tool was used to design primers for amplification of each component of the donor plasmid (Table 2) using Phusion (NEB); purified PCR products were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... mutagenic primers were designed using the New England Biolabs online software NEBaseChanger (primer sequences are available at doi: XXXX. The Q5 Site-Directed Mutagenesis Kit (New England BioLabs) was then used with the A/Baltimore/R0675/2019 hemagglutinin plasmid to produce plasmids with the desired mutations ...
-
bioRxiv - Neuroscience 2024Quote: ... The UNC13A CE was amplified with a forward primer in exon 19 5’-CAGACGATCATTGAGGTGCG-3’and reverse primer in exon 22 5’-ATACTTGGAGGAGAGGCAGG-3’using Q5 High Fidelity Master Mix (NEB). PCR products were resolved on a TapeStation 4200 (Agilent ...
-
bioRxiv - Molecular Biology 2024Quote: ... where biotin-labeled primer (Bio-R1) was supplemented together with 2x NEB Next Ultra II Q5 Master Mix (M0544L, NEB). LAM products were purified with Streptavidin C1 dynabeads (65001 ...
-
bioRxiv - Genomics 2024Quote: ... followed by a nested PCR reaction (5 cycles for 70 sec at 72◦C) with individual sample-barcoded i5 and i7 Illumina TruSeq primers (New England Biolabs NEBNext Multiplex Oligos for Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... StrepII-EPLINα WT plasmid was created by inserting the EPLINα PCR product (created with EPLINα Strep F/R primers) into pcDNA3 StrepII MCS vector cleaved with EcoRI/AgeI using NEBuilder HiFi DNA Assembly (NEB). The deletion mutants (ΔNHX ...
-
bioRxiv - Genetics 2024Quote: ... was generated by amplifying the transgene rgef-1p::PH::miniSOG::unc-54 3’UTR from pNMS03 with primers P37 and P38 containing AvrII restriction sites and cloning the fragment into pCFJ151 after AvrII (New England BioLabs) digestion ...
-
bioRxiv - Genomics 2024Quote: ... crRNAs were amplified from genomic DNA (primer sequences can be found in (Supp. Table 2) using Q5 2x Master Mix (NEB) in 100 μL reactions with the following thermal cycling parameters:
-
bioRxiv - Genomics 2024Quote: Double-stranded DNA libraries were prepared with NEBNext Ultra II DNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (New England Biolab: NEB). Around 1 ng of DNA was used for each library ...
-
bioRxiv - Genomics 2024Quote: ... The backbones for the Gibson reaction for GRB2-SH3 and PSD95-PDZ3 library assembly (aPCA plasmids) were first linearized using primers listed in Extended Data Table 3 and next treated with Dpn1 (NEB) restriction enzyme to remove the circular plasmid template ...
-
bioRxiv - Cell Biology 2020Quote: ... 250 ng of plasmid DNA was used per PCR reaction and used in a volume of 50 µl using Next High-Fidelity 2x PCR Master Mix (NEB, M0541) (according to the manufacturer’s protocol) ...
-
bioRxiv - Genomics 2020Quote: Primer-walk PCRs were performed with edited single-cell clones to identify aberrant PCR products with OneTaq 2x Master Mix (NEB M0486L) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... After that tagmended library (20 µL) was PCR amplified using 25 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, #M0541L), 2.5 µL of P5_BRB primer (5 µM ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Reporter plasmids were assembled by Gibson Assembly using promoter PCR product and pHCKan-yibDp-GFPuv PCR product following manufacturer’s protocol (New England Biolabs, Ipswhich, MA). All plasmid sequences were confirmed by DNA sequencing (Genewiz ...
-
bioRxiv - Genetics 2021Quote: ... barcodes and barcoding adapters (PCR Barcoding Expansion 1-96, EXP-PBC096, Oxford Nanopore Technologies, UK) by PCR using Q5 polymerase mastermix (NEB, USA) for individual fish identification according to manufacturer’s protocol in a 25μl reaction (98°C for 3 min ...
-
bioRxiv - Genomics 2021Quote: ... Purified DNA was subjected to an initial step of PCR amplification consisting of 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S) and standard barcoded primers of Nextera kit for each sample ...
-
bioRxiv - Plant Biology 2021Quote: ... The pooled PCR reactions were purified with the Monarch® PCR & DNA Cleanup Kit (5 μg) (New England Biolabs® Inc.) and run on 6% acrylamide gel ...
-
bioRxiv - Synthetic Biology 2022Quote: ... DNA fragments to be assembled were amplified by PCR using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, M0532S), purified with gel electrophoresis and Zymo clean Gel DNA Recovery Kit (Zymo Research,D4002) ...
-
bioRxiv - Developmental Biology 2022Quote: ... TE buffer (20 µL) was added and PCR was performed using NEBNext High-Fidelity 2X PCR Master mix (New England Biolabs, M0541) as follows ...
-
bioRxiv - Genetics 2020Quote: ... The remaining DNA was used to amplify fragments of the target site by PCR and amplicons were purified using the Monarch® PCR & DNA Cleanup Kit (NEB) following the manufacturer’s instructions and either sent for 250 bp paired end Illumina amplicon sequencing (Genewiz) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR product was denatured and annealed in an 18 μl reaction (15 μl PCR product, 2 μl NEB Buffer2 (10X), 1 μl nuclease-free H2O ...
-
bioRxiv - Genetics 2021Quote: ... 200-800 nt amplicons were amplified from genomic DNA from individual insertion lines through single fly PCR (Gloor et al., 1993) using OneTaq PCR master mix (NEB #M0271L). PCR conditions were 95°C for 30 seconds ...
-
bioRxiv - Developmental Biology 2022Quote: ... Adaptor-ligated DNA fragments of proper size were enriched with PCR reaction using Fusion High-Fidelity PCR Master Mix kit (NEB, M0531S) and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Three to four independently generated PCR products for each OT1-4/founder were purified using the Monarch PCR & DNA Cleanup Kit (NEB Inc.) and sent for Sanger sequencing at the OHSU Vollum Sequence Core.
-
bioRxiv - Synthetic Biology 2022Quote: ... DNA fragments to be assembled were amplified by PCR using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, M0532S), purified with gel electrophoresis and Zymoclean Gel DNA Recovery Kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2022Quote: ... Two to three PCR reactions per sample were combined and cleaned-up using the Monarch PCR and DNA clean-up kit (NEB, T1030S). 10-100 ng of DNA from each sample was carried forward for end-repair using the NEBNext Ultra II End repair/dA-tailing Module (NEB ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A clean-up step was performed using Qiagen MinElute PCR purification kit and PCR-amplified using NEBNext Ultra Q5 DNA polymerase master mix (New England Biolabs®) with forward primer (5’-TAGAGCATGCACC GGCAAGCAGAAGACGGCATACGAGAT[N10]ATGTCTCGTGGGCTCGGAGATGT-3’ ...
-
bioRxiv - Biochemistry 2024Quote: ... Truncated EWSR1 constructs were created by PCR-based cloning from the His-MBP-EWSR1 expression vector using inverse PCR with Phusion DNA polymerase (New England Biolabs, F530S) then DpnI digest (New England Biolabs ...
-
bioRxiv - Systems Biology 2022Quote: ... PCRs for screens with the vTR and CoV libraries were performed using NEBNext High-Fidelity 2X PCR Master Mix (NEB #M0541L) with 33 cycles ...
-
bioRxiv - Genetics 2023Quote: ... were genotyped by amplifying the fourth coding region of EDNRB1 via PCR and digesting the PCR products with the restriction enzyme BsrI (New England BioLabs, #R0527S). Both deletions eliminate cut sites for BsrI and can thus be genotyped simultaneously (S1 Fig) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Linear plasmid fragments were generated by PCR and purified by Monarch® PCR and DNA cleanup kit (New England BioLabs®). Ligations were performed with In-Fusion® enzyme at 50°C for 15 minutes (min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCRs were conducted in volumes of 30 μL comprising a Phusion® High-Fidelity PCR Master Mix (New England Biolabs) (15 μL) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Eluted fragments were amplified by PCR with an appropriate number of PCR-cycles (5-8) using Custom NExtera PCR primers50 and the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S). Amplified DNA was purified using Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Genetics 2023Quote: ... was genotyped by amplifying the fifth coding region of EDNRB1 via PCR and digesting the PCR products with the restriction enzyme SmaI (New England BioLabs, #R0141S). The R315P variant creates a cut site for SmaI (S2 Fig) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... After confirming the PCR product size with gel electrophoresis the PCR product was incubated with DpnI (NEB, Ipswich, MA, Cat #R0176S) for 1 hour at 37°C to digest the plasmid template ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transposed DNA was then purified on Diapure columns (Diagenode, Transposed purified DNA was then pre-amplified for 5 PCR Cycles using NEBNext High-Fidelity PCR MasterMix (NEB, M0541) and Illumina indexing primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... Ligation of sequences was performed by PCR-based cloning via addition of specific restriction sites using the Phusion High-Fidelity PCR Master Mix (New England Biolabs, #F531L), restriction digest and subsequent ligation using T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... Adaptor-ligated DNA fragments of proper size were enriched with PCR reaction using Phusion High-Fidelity PCR Master Mix kit (NEB, M0531S) and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1 ...
-
bioRxiv - Genomics 2024Quote: ... 10 µL of tagmented DNA was PCR amplified for 14 cycles in a 50 µL reaction volume using NEBNext High-Fidelity 2X PCR Master Mix (NEB # M0541S) and Nextera primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... Genomic regions flanking the expected cut sites for the indicated sgRNAs were PCR amplified using Q5 PCR Master Mix (NEB, #M0541L). PCR products were purified using the Monarch PCR and DNA Cleanup Kit (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: Transcription templates for expressing gRNA variants and SARS-CoV-2 or CMV input RNA fragments were generated by PCR (Phusion high-fidelity PCR kit, NEB #E0553) of the gBlock or Ultramer template that included a T7 promoter and the gRNA or input RNA coding sequence ...
-
bioRxiv - Synthetic Biology 2024Quote: ... DNA fragments to be assembled were amplified by PCR using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, M0532S). The PCR mix underwent gel electrophoresis for purification ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time quantititative PCR (qRT-PCR) detection was performed using the Luna® Universal qPCR Master Mix (M3003, New England Biolabs) and the CFX96 Real-Time PCR System ...
-
bioRxiv - Genomics 2024Quote: ... The reaction was purified using the Zymo DNA Clean & Concentrator kit and PCR-amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and primers as defined in Corces et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplification of cDNAs was performed using a high-fidelity KOD-Plus-Neo DNA polymerase (Toyobo, Japan) and resulting PCR products were cloned using NEB® PCR Cloning kit (New England BioLabs). Positive clones and plasmids were verified by DNA sequencing.
-
bioRxiv - Molecular Biology 2024Quote: ... PCR and digest products were purified using Monarch DNA Gel Extraction and PCR and DNA Clean Up Kits (NEB T1020S, T1030S).
-
bioRxiv - Genomics 2024Quote: ... the Illumina flow cell adapters were added through a 15-cycle PCR using NEBNext High-Fidelity 2x PCR Master Mix (New England BioLabs, M0541L), the forward primer pLSmP-ass-i741 and reverse primer pLSmP-ass-gfp ...
-
bioRxiv - Genomics 2024Quote: ... The purified fragment underwent a second round of 12-cycle PCR using NEBNext High-Fidelity 2x PCR Master Mix (New England BioLabs, M0541L), the forward primer 5BC-AG-f02 and the reverse primer 5BC-AG-r02 ...
-
bioRxiv - Developmental Biology 2020Quote: ... eluted in 20 μl of water and PCR amplified using 25 μl NEB Next High-Fidelity 2x PCR Master Mix (NEB, #M0541 L), 2.5 μl of P5_BRB primer (5 μM ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 µl of genomic DNA was used for screening by PCR amplification (Phusion® High-Fidelity PCR Master Mix with HF Buffer, NEB, M0531S) of the targeted genomic region ...