Labshake search
Citations for New England Biolabs :
2701 - 2750 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 50 μg/ml glycogen) and DNA purification was carried out with the PCR cleanup kit (NEB, Monarch PCR & DNA Cleanup Kit, T1030). About 10ng of the purified CUT&RUN DNA was used for preparation of multiplexed libraries with the NEB Ultra II DNA Library Prep Kit per manufacturer’s instruction (NEB #E7103) ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 ∼ 1.5 μl of DNA extract was added to 20 μl of PCR reaction mix containing standard PCR buffer and 1 unit of Taq DNA polymerase (Cat # = M0273, New England Biolabs, Beverly, MA). For long-range PCR ...
-
bioRxiv - Genetics 2020Quote: ... All the PCR was performed using NEBNext® High-Fidelity 2X PCR Master Mix (Catalog number: M0541L, New England Biolabs Inc., USA) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... and the library was amplified 4 cycles by PCR using Phusion high-fidelity PCR master mix with HF buffer (New England Biolabs cat. #M0531L). Finally ...
-
bioRxiv - Molecular Biology 2024Quote: ... 173 bp TBR-PCR target products were excised and purified using an Exo-CIP Rapid PCR Cleanup Kit (New England Biolabs, Ipswich, USA) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The fosA PCR product was cloned into the inverse PCR product from pCD13pSK using NEbuilder Hifi assembly (New England Biolabs, Ipswich, MA). Both fosA complemented derivatives of Mu208Δ fosA and Mu582 were created by incorporating the fosA gene along with a 200bp upstream region from the Mu208 genome into the att site of each genome (12).
-
bioRxiv - Evolutionary Biology 2023Quote: ... we purified the products of the ace-1 PCR (see above) using the BS664-250 Preps EZ-10 Spin Column PCR Purification kit (New England BioLabs, Evry France). The purified PCR products were then cloned (TOPO TA Cloning Kit pCR 2.1-TOPO Vector and TOP10F’ invitrogen bacteria) ...
-
bioRxiv - Plant Biology 2020Quote: ... respectively by Phusion® High-Fidelity PCR Kit (NEB) (Harashima & Schnittger ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was done with Q5 High-Fidelity Polymerase (NEB) following the manufacturer’s instructions and in the presence of 10% DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... Genotype analysis PCR was done using Phusion polymerase (NEB). For P ...
-
bioRxiv - Synthetic Biology 2021Quote: The PCR product was then circularized with electroligase (NEB) and transformed with high efficiency (≥ 1.5 million CFU/mL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... After PCR amplification samples were digested with DpnI (NEB) restriction enzyme to remove excess pUC19 template.
-
bioRxiv - Immunology 2021Quote: ... Sequences were amplified by PCR using Phusion polymerase (NEB). Amplicons were separated on 1.0 -1.8 % agarose gel ...
-
bioRxiv - Genetics 2021Quote: ... PCR products were generated by Phusion (New England Biolabs) PCR using pDEW201-PiraD as template and the primer pairs 5’-GGGGCGGCCG TTGCTGACAG GATTCAGGCC TGTCTC-3’ and 5’-GGGGCGGCCG AAACCTTACT TGCCTATGAA TATCTA-3’ for pDEW201-P1iraD and 5’-GGGGGGCCCA ATAATGCCTG TGAATGGTAT TTTTG-3’ and 5’-GGGGGGCCCG ACCTCAATAT AGCAACATCA AATTC-3’ for pDEW201-P2iraD ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR was performed using LongAmp Taq Master Mix (NEB) under the following conditions ...
-
bioRxiv - Microbiology 2019Quote: ... DNA polymerases in PCR were Phusion (New England Biolabs) for synthesis of DNA used in constructions and DreamTaq (Thermo Fisher ...
-
bioRxiv - Microbiology 2019Quote: PCR fragments were assembled using Gibson assembly kit (NEB) and verified by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... purified with the Monarch PCR & DNA Cleanup Kit (NEB) and ligated with T4 DNA ligase (NEB) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or amplified by PCR (Q5 Polymerase; New England Biolabs) to swap the restriction sites ...
-
bioRxiv - Cell Biology 2021Quote: qRT-PCRs were performed using Luna OneStep reagent (NEB) on biological triplicates ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... A 50 μl PCR using Q5 polymerase (NEB M0491S) according to the manufacturers instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The two PCR products were treated with DpnI (NEB) for 30 min at 37 “C ...
-
bioRxiv - Genomics 2019Quote: ... a PCR was performed using Taq polymerase (NEB, USA) with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich ...
-
bioRxiv - Genomics 2020Quote: ... The PCR products were digested by T7E1 enzyme (NEB), resolved on 2% agarose gel and then analyzed by densitometry measurements as described [63] ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L) was dispensed twice using the ICELL8 MSND Single Cell / TCR program for the filtered dispense tool at 50 nanoliter per well ...
-
bioRxiv - Genomics 2020Quote: ... the NEBNext High-Fidelity 2× PCR Master Mix (NEB) was used according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... PCR was performed using Taq Polymerase (New England Biolabs), and Q5 DNA Polymerase (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were cut using EcoRI and HindIII (NEB). End-labelling was done using γ32-ATP and T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Completed PCR reactions were treated with exonuclease I (NEB) according to the manufacturer’s protocol and then purified with the QIAquick PCR purification kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3xFLAG was amplified by PCR with Q5 polymerase (NEB) from our construct using primers 3xFLAG_F and 3xFLAG_R and cloned into petSUMO_NSP1_WT vector using Gibson Assembly® Master Mix (NEB) ...
-
bioRxiv - Genetics 2021Quote: ... with four inserts using Q5 polymerase PCR products (NEB): pCS2+ backbone ...
-
bioRxiv - Genetics 2019Quote: ... and NEBNext High-Fidelity 2X PCR Master Mix (NEB) which resulted in dual barcoded amplicons with illumina adapters ...
-
bioRxiv - Genomics 2021Quote: ... 25 μL NEBNext HiFi 2× PCR Master mix (NEB) was added ...
-
bioRxiv - Genomics 2019Quote: ... and contained 5 μL of Q5 PCR buffer (NEB), 0.0625 μL of 100 μM universal forward primer ...
-
bioRxiv - Genomics 2019Quote: ... and contained 5 μL of Q5 PCR buffer (NEB), 0.0625 μL of 100 μM universal forward primer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We used high-fidelity PCR (Phusion, New England Biolabs) to amplify 150bp containing the mutagenized region ...
-
bioRxiv - Microbiology 2020Quote: ... Pooled colony PCRs were performed using Q5 polymerase (NEB), annealing at 65 °C and with a 50 second extension time.
-
bioRxiv - Bioengineering 2021Quote: ... A fresh 50 μL PCR reaction with Q5 (NEB) for 16 cycles annealing at 67 °C was mixed with 1 μL of ExoI (NEB ...
-
bioRxiv - Bioengineering 2021Quote: ... Inserts were assembled by PCR with Q5 polymerase (NEB), gel purified (Epoch Life Science) ...
-
bioRxiv - Cancer Biology 2021Quote: ... a PCR-based Q5 site-directed mutagenesis kit (NEB) was used according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ORF20 or ORF20-RHIMmut were PCR amplified (Phusion, NEB), a V5 tag incorporated and inserted into the pCDH-EF1 vector ...
-
bioRxiv - Microbiology 2020Quote: ... The amplified PCR product was digested by SacI (NEB) and Hind? (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR reactions were performed using Q5 DNA polymerase (NEB) and Expand High Fidelity PCR System (Roche Life Science ...
-
bioRxiv - Systems Biology 2021Quote: ... and then purified with the Monarch PCR kit (NEB). PCR amplicons were digested using MfeI-HF and SphI-HF (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR reaction contained 1x Q5 Reaction Buffer (NEB), a detergent-free buffer containing 2.0 mM Mg++ at final 1x concentration ...
-
bioRxiv - Plant Biology 2021Quote: ... coli using the NEB® PCR Cloning Kit (NEB).
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed using Q5 polymerase (New England Biolabs) according to manufacture instructions ...
-
bioRxiv - Genomics 2020Quote: ... was amplified in 50μl PCR reactions with Q5 (NEB) using 25ng plasmid template and EF05 and EF06 primers ...
-
bioRxiv - Genomics 2020Quote: ... was amplified in 50μl PCR reactions with Q5 (NEB) using 25ng plasmid template and EF07 and EF08 primers ...
-
bioRxiv - Microbiology 2020Quote: ... Synthesized DNA was amplified by PCR (NEB Q5 polymerase) and cloned into pDONR/Zeo (Thermo ...