Labshake search
Citations for New England Biolabs :
3001 - 3050 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... The lineage barcode oligo mix was cloned downstream of the Read2 partial primer sequence in the purified donor plasmid via multiple Gibson Assembly reactions (NEB, E2611S). Gibson assembly reactions were then pooled and desalted with 0.025 µm MCE membrane (Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... The 2X FLAG sequence was introduced via PCR as an oligonucleotide primer along with a reverse primer that produced the 3’ CNA1 UTR and cloned by use of the Gibson Assembly Cloning Kit (NEB #E5510S). The identity of the vector pCnat-CNA1-2X FLAG was also confirmed by sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... followed by PCR amplification of the gRNA cassette using primers compatible with Illumina sequencing and NEB Q5 Hot Start High-Fidelity master mix (NEB M0494) (see primers listed in Supplemental Table 1) ...
-
bioRxiv - Genomics 2023Quote: ... using 0.3 μM of dual-indices primers (forward: 5’:AATGATACGGCGACCACCGAGATCTACACCTCCAAGTTCACACTC TTTCCCTACACGACGCTCTTCCGATCT-3’; reverse 5’-CAAGCAGAAGACGGCATACGAG ATCGAAGTATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCAAACTGGGG CACAAGC-3’) and amplified using Q5 2X master mix (NEB #M0541S) according to the following protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The libraries were then prepared by digesting the hairpin structures on both primer adaptors using Uracil-Specific Excision Reagent (USER) enzyme (NEB; M5505) and a following PCR amplification for 16 cycles with Truseq barcoded primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... pPGK1-mCherry was amplified from the mCherry plasmid described in (Tunney et al. 2018) using uracil-containing primers with Q5U polymerase (New England BioLabs, M0515) and inserted into EasyClone plasmid pCfB2226 by USER cloning upstream of the ADH1 terminator with USER Enzyme Mix (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared by amplifying the sgID-BC region from 32μg of genomic DNA per mouse using unique dual-indexed primers and the Q5 Ultra II 2x Master Mix (New England Biolabs, M0544X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Bioengineering 2024Quote: ... This strategy avoids 3’-terminal editing of the mismatched primers by the 3’-5’ exonuclease activity of Q5® High-Fidelity DNA Polymerase (NEB), increasing PCR specificity.61
-
bioRxiv - Biochemistry 2024Quote: The coding sequence of human EIF4EBP1 (NM_004095.4) was amplified from cDNA derived from HepG2 cells using primers containing restriction sites using Q5 polymerase (New England Biolabs, M0491). PCR products were cloned into suitable vectors using restriction digest followed by ligation ...
-
bioRxiv - Microbiology 2024Quote: ... An enzymatic cleanup was done to remove primer dimers and inactivate nucleotides by directly adding 0.5µL of Antarctic phosphatase and Exonuclease 1 (New England Biolabs, Inc; M0293L, M0289L) and 1.22µL Antarctic phosphatase buffer (1x final concentration ...
-
bioRxiv - Microbiology 2024Quote: Library preparation and sequencing were conducted using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina with dual index primers and ∼300 ng of DNA (NEB Inc.) on an automation platform (Biomeki5 ...
-
bioRxiv - Genetics 2024Quote: ... amplified from pCZGY2851 (gift from Andrew Chisholm) with primers P33 and P34 using NEBuilder® HiFi DNA Assembly (New England BioLabs). pNMS03 (40 ng/μl ...
-
bioRxiv - Genetics 2024Quote: ... with primers (Integrated DNA Technologies, Coralville IA) designed to provide flanking homology arms for HiFi assembly (New England Biolabs, Ipswich MA) into EcoRI/NotI-digested (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... and utilized for library constructions with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina along with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs; NEB; # E7760L). The libraries were sequenced on the NovaSeq platform as paired-end reads using the S1 v1.5 kit with 300 cycles (Illumina) ...
-
bioRxiv - Molecular Biology 2024Quote: ... ssSynth primer was extended by adding 1 μL 10mM dNTP’s (Fisher cat#FERR0192) and 1 μL Klenow polymerase (NEB cat#M0210S) then incubating at 37°C for 1hr ...
-
bioRxiv - Zoology 2024Quote: ... we generated a template for dsRNA synthesis by amplifying targeted coding sequences from cDNA using gene-specific primers with T7 overhangs and Q5 High-Fidelity DNA Polymerase (NEB, M0491S). Two rounds of PCR reactions (each with 35 cycles ...
-
bioRxiv - Genomics 2022Quote: ... Strand-specific RNA sequencing library and small RNA sequencing libraries were generated respectively using NEBNext® Ultra™ RNA Library Prep Kit and NEBNext® Multiplex Small RNA Library Prep Set for Illumina® (NEB, Ipswich, MA, USA). After the cDNA synthesis and PCR amplification ...
-
bioRxiv - Microbiology 2019Quote: ... All PCR reactions were carried out with Phusion® High-Fidelity PCR Master Mix with GC Buffer (New England Biolabs, Ipswich, MA, USA) and high-fidelity polymerase (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: Pooled sgRNA oligonucleotides were synthesized as 76-mers by Custom Array (Bothell, WA, USA) and were amplified by PCR with NEBNext High Fidelity PCR Master Mix (New England BioLabs, NEB, Ipswich, MA, USA) using customized primers (Additional file 2 ...
-
bioRxiv - Plant Biology 2021Quote: The first round of PCR was performed using 1X Phusion High-Fidelity PCR Master Mix with HF Buffer (New England BioLabs; Ipswitch, MA, USA) with forward primer “reverse transcription primer (RTP)” ...
-
bioRxiv - Plant Biology 2021Quote: The first round of PCR was performed using 1X Phusion High-Fidelity PCR Master Mix with HF Buffer (New England BioLabs; Ipswitch, MA, USA) with cDNA diluted 1:10 in water ...
-
bioRxiv - Zoology 2020Quote: ... of the reaction was then checked for successful amplification on a 1% agarose with the 1 kb DNA Ladder from New England Biolabs and afterwards the remaining PCR product was purified using the Monarch® PCR & DNA Cleanup Kit (New England Biolabs; Ipswich, MA). Purified products for S ...
-
bioRxiv - Genomics 2023Quote: ... Amplification of the libraries was performed for 13 PCR cycles using the Phusion High-Fidelity PCR Master Mix (New England Biolabs, cat. no. M0531L); 6-bp molecular barcodes were also incorporated during this PCR amplification ...
-
bioRxiv - Plant Biology 2020Quote: ... and DNA templates and primers listed in Additional Table 1 and cloned into pH7WG plasmid linearized with SalI-HF (NEB, Cataog # R3138S) and AscI (NEB ...
-
bioRxiv - Plant Biology 2020Quote: ... The amplification of the GC-rich region (primer 1) was performed with high fidelity Q5 polymerase (New England Biolabs Inc, Ipswich, MA) using the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... 45 μl of cDNA from the synthesis reaction was mixed with primers and Q5® High-Fidelity 2X Master Mix(NEB, USA). The PCR program began with an initial denaturation at 95°C for 1.5minutes ...
-
bioRxiv - Genetics 2019Quote: ... Exon 14b was amplified with primers F: GACATGTTGCTAAGATTGAAATCCGT from exon 14 and R: GACCCAGCTTTCAGAGTAACCAGAAC from exon 15 using Phusion polymerase (NEB, Ipswich, MA). The longer band containing exon14b was then excised from the gel and purified using Zymoclean gel DNA recovery kit (Zymoresearch ...
-
bioRxiv - Biochemistry 2021Quote: ... The relinearized single-stranded DNA template was subjected to PCR amplification by using barcoded primers for Illumina TrueSeq small RNA sample and Phusion High-Fidelity DNA Polymerase (2 U; M0530L, NEB, Ipswich, MA). Subsequently ...
-
bioRxiv - Cell Biology 2021Quote: ... Amplification of cDNA was conducted using T7 forward primers and cDNA-based RNA was generated using HiScribeTM T7 Quick High-Yield RNA Synthesis kit (New England Biolabs, Ipswich, MA). T7 RNA (1 μg ...
-
bioRxiv - Plant Biology 2020Quote: ... and blotted to a membrane followed by hybridization with radioactive probe [62] prepared using the random primers labelingNEBlot® kit (New England Biolabs, USA). The band detection was carried out using Typhoon® phosphor imager (GE Healthcare ...
-
bioRxiv - Genomics 2020Quote: ... primers were designed to target the unique genomic DNA flanking the mariner insertion (Fig. S2A, Table S6; NEB Q5-HF polymerase #M0492). Amplicons were run on a 1% agarose gel to determine presence/absence of the insertion ...
-
bioRxiv - Neuroscience 2022Quote: The 16S rRNA V4 region was amplified using the following primers 515f-Y: GTGYCAGCMGCCGCGGTA and 806r-N: GGACTACNVGGGTWTCTAAT and The Q5® high-fidelity DNA polymerase kit (New England BioLabs, UK). 2μl of extracted DNA was added to a PCR reaction mix prepared by mixing a final concentration of 1X Q5 reaction buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... reverse primer: ACCGCCTCC ACCGGATCTGAGTTACAAGGATGTTATATCATT) and the fragment was cloned into the vector using NEBuilder®HiFi DNA Assembly Master Mix (NEB, #E2621L) to generate a sequence encoding mNG-40L-TPM2 under control of a CMV promoter ...
-
bioRxiv - Molecular Biology 2020Quote: ... sgRNA target site mutation in mouse Thap1 cDNA was generated by Q5 Site-Directed Mutagenesis Kit (NEB, see Table S3 for primers). WT or Thap1-/-Brca1Δ11 MEFs (1 × 106 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNAs were reverse transcribed to cDNA using ProtoScript II reverse transcriptase with oligo dT and random primers (First Strand cDNA Synthesis kit New England Biolabs, Ipswich, MA). RT-PCRs specific for the Cas9 or actin gene of B ...
-
bioRxiv - Plant Biology 2021Quote: ... mRNA was enriched with oligo(dT)-beads and cDNA was synthesized with random hexamer primers with the NEB Next Ultra RNA Library Prep Kit (NEB, Ipswich, USA). All libraries were sequenced using the Illumina NovaSeq6000 platform in paired-end mode with a read length of 150 bp.
-
bioRxiv - Immunology 2020Quote: ... G and C and lower case ‘g’ represents RNA bases) and the uracil-containing primers subsequently removed by treatment with UDG (NEB, Hitchin, UK). TRA and TRB sequences were amplified using a pair of 5’ ‘step-out’ primers specific for the SMART oligo (long 5’ primer - CTA ATA CGA CTC ACT ATA GGG CAA GCA GTG GTA TCA ACG CAG AGT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Bs.gltX and Dr.AspRS were amplified by primers with 20bp overlap to the vector and ligated to the EcoRI / XbaI-digested-vector respectively using Gibson method (NEB, Cat# E2611) where the inserts were under control of arabinose-inducible promoter.
-
bioRxiv - Microbiology 2020Quote: ... the algR gene was amplified from gDNA using primers (algR-pUC-5, algR-pUC-3) and subcloned into pUC19 (New England Biolabs, Ipswich, MA). Site-directed mutagenesis was performed by amplification of pUC19::algR with primers (algR-D54E-Fw ...
-
bioRxiv - Microbiology 2020Quote: ... RNA (25-100 ng) was mixed with random oligonucleotide primers using the NEBNext® First Strand Synthesis Module kit for Illumina® (NEB) and incubated for 10 min at 94°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Genomic loci were then amplified using primers targeting genes of interest (see Table S9 for a list of primers) using Q5 Hot Start High-fidelity 2X Master Mix (NEB, Cat. #M0494). One exception was the CHD sextyping amplification protocol ...
-
bioRxiv - Genomics 2021Quote: ... qRT-PCR was subsequently performed with primers specific for edited genes and fly sequences using Luna Universal qPCR Mix (New England Biolabs, Ipswich, Massachusetts) and Biorad CFX ConnectTM Real-Time PCR Detection System (BioRad ...
-
bioRxiv - Biophysics 2021Quote: ... was annealed with primer P3 (100 bp long) at a 1:3 DNA to primer molar ratio and ligated using T4 DNA ligase (NEB, catalog #M0202S). Primer P3 had biotin modification at its 3’ end ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation was performed using the NEB ultra DNA library preparation kit for Illmina (E7370) and Indexing primers (E7335S and E7500S) (New England Biolabs Inc, UK), following protocols described previously (Colles ...
-
bioRxiv - Microbiology 2022Quote: Single-stranded cDNA was used as a template for PCR amplification to amplify all eight genes using segment specific primers using high-fidelity Phusion 2X DNA polymerase (New England BioLabs, Inc., USA). Primer sequences are available in the GitHub repository accompanying this manuscript 33 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were fused with primers 169/170 and cloned into pLVX-TetOne-Zeo using the KpnI and NheI restriction sites (New England Biolabs, Ipswich, MA). The new vector is renamed pLVX-SIN-TetOne-Zeo (pSTZ ...
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Microbiology 2024Quote: ... GM16 genomic DNA using primers SA-Reg FWD and SA-Reg REV (Table 4) and polymerase Q5 (New England Biolabs, Massachusetts, USA). The destination plasmid pGW44 [33] was linearized using primers pGW44 FWD and pGW44 REV ...
-
bioRxiv - Microbiology 2024Quote: ... primers were designed to clone Ceg10 into pET28b using restriction enzymes NdeI and NotI by HiFi DNA Assemby kit (NEB; Table S4), producing the His6x-TEV-Ceg10 vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...