Labshake search
Citations for New England Biolabs :
2901 - 2950 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 500 ng of total RNA was used to synthesize cDNA using the LunaScript RT SuperMix Kit (New England Biolabs, E3010L). The Luna Universal qPCR Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: Quantification of SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was conducted using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a Step One Plus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Complementary DNA (cDNA) was prepared from total RNA (5 μg) by reverse transcription using LunaScript® RT SuperMix Kit (NEB). qPCR reactions were performed using Power SYBR Green Master Mix (Thermo ...
-
bioRxiv - Cell Biology 2023Quote: ... Ligated junctions were pulled-down with Dynabeads® MyOne™ Streptavidin C1 beads for 15 min at RT and DNA ends were A-tailed with 15 Units of Klenow exo- (cat. M0212L, NEB). Barcoded PerkinElmer adapters (cat ...
-
bioRxiv - Microbiology 2022Quote: ... and the extracted RNA was reverse transcribed using LunaScript® RT SuperMix Kit (Cat. NEB #E3010; New England Biolabs, MA). The feline IFNγ mRNA were evaluated using primers (5’AATACCAGCTCCAGTAAACGG 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... and the extracted RNA was reverse transcribed using LunaScript® RT SuperMix Kit (Cat. NEB #E3010; New England Biolabs, MA). The feline IFNγ mRNA were evaluated using primers (5’AATACCAGCTCCAGTAAACGG 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription was performed on 500 ng of total RNA using a LunaScript™ RT SuperMix Kit (New England Biolabs) as according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR for SARS-CoV-2 from cell lysates was performed using the TaqMan assay for the CDC N1 gene primers and probes from Integrated DNA Technologies (catalog no. 10006600; Integrated DNA Technologies) using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) as previously described (6) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL lysate was used as a template for the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Plant Biology 2023Quote: ... And 1 µg of the total RNA was reverse transcribed into cDNA using Luna script RT Supermix (New England Biolabs) as per the manufacture’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... Ligated junctions were pulled-down with Dynabeads® MyOne™ Streptavidin C1 beads for 15 min at RT and DNA ends were A-tailed with 15 Units of Klenow exo- (cat. M0212L, NEB). Barcoded PerkinElmer adapters (cat ...
-
bioRxiv - Physiology 2023Quote: ... was obtained by reverse transcription (RT) using 1 μg of RNA and Moloney murine leukaemia virus (M-MuLV) reverse transcriptase (M0253, NEB), using the first strand cDNA synthesis standard protocol with random primers (S1330 ...
-
bioRxiv - Plant Biology 2023Quote: ... The reactions were completed in a final volume of 10 µl using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs), and relative gene expression analysis using the Livak method was per-formed 53 ...
-
bioRxiv - Biochemistry 2022Quote: ... The resulting RNA was used to generate cDNA using the LunaScript®RT SuperMix Kit according to the manufacture’s protocol (New England Biolabs).
-
bioRxiv - Biochemistry 2023Quote: ... 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′) and the Luna Universal Probe one-step RT-qPCR kit (catalog no. E3006; New England Biolabs). A 20-μL RT-qPCR mixture contained 7 μL of sample ...
-
bioRxiv - Bioengineering 2023Quote: RT-qPCR was carried out from the isolated RNA using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) following the manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Up to 1ug of RNA is then converted into cDNA using the NEB LunaScript® RT Supermix Kit (NEB #E3010) followed by qPCR using the NEB Luna Universal qPCR Master Mix (NEB #M3003) ...
-
bioRxiv - Microbiology 2024Quote: The 5’ end of the sigAb transcript was identified using 5’ RACE following manufacturer’s protocol with template switching RT enzyme mix (NEB; M0466). Briefly ...
-
bioRxiv - Plant Biology 2024Quote: ... graminearum or mock inoculated was treated with DNAse and cDNA was synthesized using LunaSCript RT MasterMix kit (New England Biolabs), with random hexamer and oligo-dT primers ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA pellet was resuspended in 50 µl of RNase-free H2O and 1 µl of the resuspended samples was used for quantification of the DENV-2 D220 NS5 RNA regions using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in a 10-ul reaction volume ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 20 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 500 nM of each primer CCCTGTGGGTTTTACACTTAAAAAC and CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 10 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 1 µM of each primer ...
-
bioRxiv - Biochemistry 2024Quote: To prepare the RNA for a MaP-RT reaction with a template switching oligonucleotide (TSO, Table S3) the Vaccinia Capping System (NEB) was used without the addition of SAM to add a guanylate cap (Gcap ...
-
bioRxiv - Genetics 2024Quote: ... Reverse transcription was performed with 1 µg of RNA using one-step reaction using LunaScript RT SuperMix Kit (NEB, #E3010) as indicated by the manufacturer ...
-
bioRxiv - Cell Biology 2020Quote: Primers were designed to generate overlapping fragments that were assembled using the Gibson assembly master mix (New England Biolabs, Ipswich, MA) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... pUASTattB-3xHA::amxFL described above was used as a template to amplify and add appropriate homology arms to the SS-3xHA::Amx DNA sequence with the primers 5’- CCCCGCTCTATCTGACCAAAGCCACCATGAGGCTCCAACGAC-3’ and 5’- AAAACTAAACTAAGAACGGACTACTATATGTAAAGTGAGCCATCCGC-3’ using Q5® High-Fidelity 2X Master Mix (M0492S, NEB). The section of pattB-amx plasmid containing the amx regulatory elements was linearized by PCR using Q5 polymerase and primers 5’- CGTTGGAGCCTCATGGTGGCTTTGGTCAGATAGAGCG-3’ and 5’- GCTCACTTTACATATAGTAGTCCGTTCTTAGTTTAGTTTTACAGGGGT-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... The four exons and three introns of Mlst8 were PCR amplified with primers listed in Table S1 and then cloned into the pCAG backbone using the Gibson Assembly Master Mix (NEB, #E2611S). Similarly ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... with NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolab E7420L) and NEBnext Multiplex Oligos for Illumina Dual Index Primers (New England Biolabs E7600S), using provided protocols and 500 ng of total RNA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... lyrata respectively using 0.2 µM primers designed against ASY3 cDNA sequences obtained above (S5 Table) and Q5® High-Fidelity DNA Polymerase (New England Biolabs). PCR conditions were as follows ...
-
bioRxiv - Developmental Biology 2021Quote: ... A T7 RNA polymerase binding site with short 5’-tail (aaaaTAATACGACTCACTATAG) was added to reverse primers for transcription using T7 RNA polymerase incorporating DIG labelled ribonucleotides (NEB, Roche). PCR amplified probe templates were confirmed by sanger sequencing.
-
bioRxiv - Microbiology 2019Quote: ... Zip codes were amplified from 100 ng of genomic DNA using primers flanking the zip code region (primers: 5‘-NNACGAAGACAAGATATCCTTGATC-3’ and 5’-NNTGTGTGGTAGATCCACATCG-3’) using Phusion® High-Fidelity DNA Polymerase (New England Biolabs) in HF Buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... The gRNAs targeting SERPINB5 and Tnf were created by site-directed mutagenesis of pLenti-Il33gRNA6-puro using primers listed in Supplementary Table S2 and the Q5® Site-Directed Mutagenesis Kit (NEB) according to manufacturer protocol ...
-
bioRxiv - Bioengineering 2019Quote: Codon-optimized AcrIIC3𝒩me and AcrIIA4Lmo sequences were ordered as gBlocks (IDT) and amplified using the primers with overhangs to the pCSDest vector by NEBuilder® HiFi DNA Assembly (NEB). Similarly ...
-
bioRxiv - Cell Biology 2019Quote: ... 500ng of RNA from MEFs or 350ng of RNA from BMDMs were reverse transcribed using oligo(dT)18 primer (New England Biolabs, #513165) and SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... GCaMP6s was cloned by PCR from pK152 with primer pairs LW010/LW011 and was ligated into SalI/EcoRV site of pK068 vectors by using NEBuilder (New England BioLabs: E5520S). For pK326 ...
-
bioRxiv - Microbiology 2020Quote: ... and indexed with the NEBNext Multiplex Oligos for Illumina 96 Unique Dual Index Primer Pairs (New England Biolabs, Part Number E6442S). Libraries were sequenced on Illumina’s NextSeq 550 System (Illumina ...
-
bioRxiv - Biochemistry 2021Quote: Genes drmA and drmB were amplified from genomic DNA of Serratia sp. SCBI using primers X and X (Sup. Table X) with Q5 DNA Polymerase (NEB: M0491S) as indicated by the manufacturer ...
-
bioRxiv - Biophysics 2021Quote: ... Mutagenic PCR to obtain the D614G amino acid change into both untagged and 161/345A4-tagged SΔTM constructs was done using the primers S2_D614_Q5-F and S2_D614_Q5-R (Table S1) and the Q5® Site-Directed Mutagenesis Kit (NEB®, Ipswich, MA, USA) according to the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse (ccagtgagcttcccgttca) primers with Q5 High fidelity DNA polymerase according to the standard protocol described by the manufacturer (New England BioLabs®). The PCR products obtained after 35 cycles were separated through a 1% agarose gel ...
-
bioRxiv - Biochemistry 2021Quote: ... Quantification of libraries prior to sequencing used qPCR with primers specific to the Illumina P5 and P7 adaptor sequences and standards from the NEBNext Library Quant Kit (NEB, E7630S). Sequencing of prepared libraries was performed using an Illumina MiniSeq with the 75-cycle high-output kit ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Genetics 2021Quote: ... The target genes were amplified using the above described primers with the Q5® Hot Start High-Fidelity DNA Polymerase (NEB). Touch-down PCR protocol was used to avoid possible off-target amplification ...
-
bioRxiv - Plant Biology 2021Quote: ... deltoides xylem cDNA library (primers listed in Supplemental file 1) using Q5 High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA) and cloned in a pENTR vector (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: Amplicon libraries were constructed using locus-specific primers as shown in the Supplementary Table using Q5® High-Fidelity DNA Polymerase (New England Biolabs). One primer of each pair contains an 8-nucleotide UMI and both contain adapter overhangs to multiplex the library using Bar ...
-
bioRxiv - Biochemistry 2022Quote: ... and 4.5 μM biotinylated primer oligo IF238 (5/Biosg/TC TCC TCC TTC T) were annealed in T4 ligase reaction buffer (NEB B0202S). The mixture was heated to 75°C for 5 min and cooled to 4°C at a rate of −1°C min−1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... was cloned by single point mutation encoded on the primer used to amplify pCMV-EML4-ALK-P2A-H2B-iRFP followed by blunt end ligation using NEB T4 ligase (NEB, #M0202). Constructs for generation of stable cell lines were cloned into pHR lentiviral or CLPIT retroviral plasmid backbones ...
-
bioRxiv - Biochemistry 2022Quote: ... Both primers were annealed to a DNA template and ligated by RNA ligase 2 of bacteriophage T4 (New England BioLabs Inc.). White and gray blocks represent RNA and DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% SDS) at 60°C with primers (Table S3) radiolabeled at their 5’-end using T4 Polynucleotide Kinase (NEB, Cat# M0201S) and γ-32P ATP according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Expression profiles of the genes listed below were analyzed with the specified primers using Luna® Universal qPCR Master Mix (NEB). Quantitative RT-PCR was performed using StepOnePlus (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... 66 and 51 bp fragments were amplified by PCR using as template the cDNA obtained from infected Arabidopsis plants with designated primer pairs introducing EcoRI at the N-terminal and XhoI (NEB, CAD) at the C-terminal end (Table S1) ...