Labshake search
Citations for New England Biolabs :
2651 - 2700 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Exon 3 of Smad4 was amplified by PCR using the Q5 High Fidelity DNA polymerase (M0491S; NEB). Smad4 primers used were FWD ...
-
bioRxiv - Developmental Biology 2024Quote: ... libraries were generated by PCR amplification using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs) and purified using Agencourt AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The assembled plasmid was transformed into NEB 5-alpha (high efficiency) competent cells (New England Biolabs; C2987). After verifying the sequence ...
-
bioRxiv - Bioengineering 2024Quote: Primers were synthesized by Thermo Scientific and routine PCR amplifications were carried out using Phusion High Fidelity DNA Polymerase (New England Biolabs, UK). Chromosomal modifications were engineered in A ...
-
bioRxiv - Biochemistry 2024Quote: ... the pSEVA plasmid was amplified by PCR using the Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the Fwd_GFP_rep_AN (ATGCGTAAAGGAGAAGAACTTTTCAC ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2015) using indexed and non-indexed primers and NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541) in a thermomixer with the following program ...
-
β-1,6-glucan plays a central role in the structure and remodeling of the bilaminate fungal cell wallbioRxiv - Microbiology 2024Quote: ... PCR reactions to amplify sgRNA and CaCas9 were carried out using Phusion High-Fidelity DNA polymerase (NEB), and Q5 polymerase (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... Size-selected cDNA was then PCR amplified for 12 cycles using Q5 High-fidelity polymerase (NEB #M0491S). Amplified libraries were then run on a 6% TBE gel ...
-
bioRxiv - Genomics 2024Quote: ... and used as a template for a two-step PCR with Phusion High-Fidelity DNA polymerase (NEB) and primers in Supplementary Table 7 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All DNA fragments were amplified using Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs). DNA fragments were purified with NucleoSpin™ gel and PCR clean-up kits (Macherey-Nagel ...
-
bioRxiv - Synthetic Biology 2024Quote: ... DNA was amplified by PCR in 25 μL reactions using Q5® High-Fidelity DNA Polymerase (NEB). All PCR reactions were set up according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutated product was transformed into chemically competent Escherichia coli (C2987H) through a High Efficiency Transformation (NEB). Colonies were isolated via growth on selective media (LB carbenicillin+) ...
-
bioRxiv - Cell Biology 2024Quote: ... Both amplicons were generated through PCR with Q5 Hot Start High-Fidelity 2X Master Mix (NEB #M0494) using primers listed in Table S2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Primer amplicons were generated through PCR using Q5 Hot Start High-Fidelity 2X Master Mix (NEB #M0494). G-protein-coupled receptors (Ste2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Exon 9 of daf-2 was amplified with Phusion High-Fidelity DNA polymerase (New England Biolabs, M0530S) using primers F_Primer ...
-
bioRxiv - Microbiology 2024Quote: ... Constructs for chlamydial transformation were cloned using high-fidelity (HiFi) cloning system from New England BioLabs (NEB). Primers were designed using the NEBuilder online primer generation tool (https://nebuilderv1.neb.com) ...
-
bioRxiv - Cell Biology 2024Quote: ... Library samples were enriched with 11 cycles of PCR amplification in 50uL of total reaction volume (10uL 5x KAPA buffer, 1.5uL 10 mM dNTPs, 0.5uL 10 mM NEB Universal PCR primer ...
-
bioRxiv - Cancer Biology 2023Quote: Pellets were resuspended in 99.25 µL micrococcal nuclease reaction buffer (1:10 micrococcal nuclease 10 x buffer (NEB), 1:100 10 mg/mL BSA in distilled water ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl 10 mM ATP (NEB, 0756), 1 µl 100 mM DTT (Cell Signaling Technology Europe ...
-
bioRxiv - Cell Biology 2020Quote: ... and 10% NP-40 (New England Biolabs) at 37°C for 60 mins.
-
bioRxiv - Genetics 2021Quote: ... 10 μL of Proteinase K (NEB, P8107S) was added to each sample and the sample was mixed well by pipetting ...
-
bioRxiv - Molecular Biology 2021Quote: ... Antarctic phosphatase from NEB (# M0289S-10 units), snake venom phosphodiesterase I (0.2 units ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of T4 DNA ligase (NEB), and 3 μl of nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... and 10 units of Exonuclease V (NEB) in nuclease-free water ...
-
bioRxiv - Genomics 2019Quote: ... 5 µL PNK (10 U/µL, NEB) was added ...
-
bioRxiv - Genomics 2019Quote: ... 0.3 µL of 10 mM ATP (NEB) and 0.33 µL of nuclease-free water ...
-
bioRxiv - Microbiology 2019Quote: ... 10 U of RNase Inhibitor (Murine, NEB), 0.5 mM each dNTP mix and 5 mM DTT in a final volume of 10 μL ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 µM (nucleotide) linear φX174 dsDNA (NEB) was added to the mixture to initiate the three-strand exchange reaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 μl 10mM ATP (New England Biolabs), 2 μl T4 ligase (New England Biolabs) ...
-
bioRxiv - Genetics 2020Quote: ... We added 10 µL rSAP (NEB #M0371L) and incubated at 37°C for 1 h to prevent plasmid re-ligation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 μL of 10 mM biotin (NEB) was then added to each sample on the plate and incubated for an additional five minutes to compete away purely biotin-dependent interactions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 U μL-1T4 Rnl2 (truncated) (NEB) and incubating for 3 hr at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 U of AMV reverse transcriptase (NEB) was added ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... coli DH 10-beta (New England Biolabs) was transformed with Gibson assembly product ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 U DpnI (New England BioLabs #R0176L) was added and sample processing continued as described [49].
-
bioRxiv - Cell Biology 2022Quote: ... 10 ul of 10X G5 buffer (NEB), and 1ul of Endo H HF (NEB) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10-100 nM M13mp18 scaffold (Bayou Biolabs) was incubated with an excess of staple strands (IDT) ...
-
bioRxiv - Cell Biology 2022Quote: ... A 10 μl Gibson ligation reaction (NEB) was performed using 5 ng of the gel-purified inserts and 12.5 ng of the vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... coli strain 10-beta (New England Biolabs) or TOP10 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and treated with 10 units RppH (NEB) and 30 units T4 PNK (NEB) ...
-
bioRxiv - Genetics 2022Quote: ... 10 U of T7EI ((M0302S, NEB, USA) was added and incubated at 37 ℃ for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... and 10 mM DTT (New England BioLabs). Lysates were centrifugated at 14,000 g for 10 min at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μl 50% PEG 8000 (NEB, M0242), 1 μl 40 U μl-1 RNase Inhibitor (NEB ...
-
bioRxiv - Physiology 2019Quote: ... 4 μl of 10% NP-40 (NEB) and 8 μl of PNGase F (NEB ...
-
bioRxiv - Systems Biology 2019Quote: ... 10 U of T4 DNA ligase (NEB) and 33µl of T4 DNA ligase buffer (10x ...
-
bioRxiv - Systems Biology 2019Quote: ... and 10 U of RNase H (NEB) with RNase H buffer (10X ...
-
bioRxiv - Cell Biology 2019Quote: ... A 10 μl Gibson ligation reaction (NEB) was performed using 5 ng of the gel-purified inserts and 12.5 ng of the vector ...
-
bioRxiv - Genetics 2019Quote: ... and 10 U DNA polymerase I (NEB), made up to a final volume of 50 μl with H20.
-
bioRxiv - Genomics 2019Quote: ... 10 mg/ml BSA (NEB, Ipswich, America), T4 DNA ligase (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... MNase (10 Units/sample; New England Biolabs) was added and reactions were incubated for 40 min at 37°C ...