Labshake search
Citations for New England Biolabs :
2701 - 2750 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2019Quote: ... coli NEB 10-beta (New England Biolabs) was grown at 37 °C in LB medium supplemented with appropriate antibiotics as necessary for plasmid preparation ...
-
bioRxiv - Microbiology 2021Quote: ... 10 units of BstUI (Nex England Biolabs) were added to each reaction and incubation was conducted at 37°C for 3 h ...
-
bioRxiv - Genomics 2020Quote: ... 10 U T4-βGT (NEB, Ipswich, MA). The reaction was initiated by adding Fe (II ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 µl 5x GC Buffer (NEB, USA), 1 µl dNTP mix (10 mM each ...
-
bioRxiv - Genomics 2021Quote: ... and 10 U T4 RNA Ligase1 (NEB). Reaction mixtures were incubated at 37°C for 2.5 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and 10 mM DTT (New England BioLabs), and centrifugated at 20,000 g for 2 min at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... 10 U of enzyme (NEB, cat# R0543) was used in a 50 μl-reaction containing 5 μl of NEBuffer r3.1 (10X ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of 2% BSA (NEB B9000S), 2 μl of 20 U/mL SUPERaseIn ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli 10-beta cells (New England Biolabs) with 5 μl of the assembly mix according to the protocol provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 10 units T4 PNK enzyme (NEB) at 37 °C for 30 min.
-
bioRxiv - Genomics 2022Quote: ... 10 µL 25U/µL MboI (NEB, #R0147L) and 5 µL water were added to each tube and incubate at 37°C with rotation for 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... or with 10 µL RNaseH (NEB # M0297S) for 30 min at 37°C.
-
bioRxiv - Molecular Biology 2024Quote: ... 10 U of T4 Polynucleotide Kinase (NEB) and 40 U Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µM of dNTPs (New England Biolabs) and 10 µM of primer XhoI-T7-5’ [AGCTCTCGAGACCATGAACACCATCAATATTGCC] and EcoRI-§-T7-3’ [GCATGAATTCTCAGGCAAATGCGAAATCGGA] ...
-
bioRxiv - Biophysics 2024Quote: ... 10 units of calf intestinal phosphatase (NEB), 5 units of antarctic phosphatase (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM ribonucleoside-vanadyl complex (NEB, S1402S)) and incubated overnight at 37°C in a humidified chamber ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 µl of 10× CutSmart buffer (NEB), 2.5 µl 100× Protease inhibitor cocktail and 1 µl of CviKI-1 (5 U/100,000 nuclei ...
-
bioRxiv - Bioengineering 2023Quote: ... Escherichia coli 10-beta (New England Biolabs) was used for plasmid construction ...
-
bioRxiv - Bioengineering 2023Quote: ... NEB 10-beta (NEB cat. no. C3019), or NEB Stable (NEB cat ...
-
bioRxiv - Microbiology 2023Quote: ... 10% NEBuffer 3 (New England Biolabs, #B7003S) in a thermocycler at 85°C for 3 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 U/mL of DNaseI (NEB, M0303S), 1x cOmplete™ protease inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2023Quote: ... 10 units of restriction enzyme XhoI (NEB) were added to the nucleosome array with and without PU.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RP1 primer (NEB), 1 µL ddH2O and PCR amplified for 16-18 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RPI primer (NEB), 2 µL 10 µM RP1 primer (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10×T4 ligase buffer (NEB), 0.2 μl 0.1 M ATP (Thermo Fisher) ...
-
bioRxiv - Genomics 2023Quote: ... restriction enzyme (10 units of HpyCH4IV [NEB] for PCR7 and PCR31 ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 mM (NEB, cat. no. N0447S/L)
-
bioRxiv - Neuroscience 2023Quote: ... in 1:10 CutSmart Buffer (BioLabs #B6004S) at 37°C for 1 hour ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 U of T7 endonuclease I (NEB) was added and incubated for 15 min at 37°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Scaffold strands (10 nM, M13mp18, Bayou Biolabs) were mixed with staple strands (100 nM ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL 10×ThermoPol Reaction Buffer (NEB), 0.5 μL 10 mM dNTP mix ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 units of RNaseH (New England Biolabs) were added to the mix and allowed to digest at 37°C for 1 h ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 µL HiFi 2X Master Mix (NEB), and water up to 20 µL ...
-
bioRxiv - Synthetic Biology 2023Quote: Restriction endonuclease BsaI (10 U/μL) (NEB), supplied with 10x NEB Buffer.
-
bioRxiv - Genomics 2023Quote: ... 10 μl Large Klenow Fragment (NEB #M0210L) was added and the chromatin is incubated for 15 min at 37°C with shaking ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 U T4 RNA ligase 1 (NEB), 50 mM Tris-HCl pH=7.5 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 10 units of T4 RNA ligase (NEB), 1X T4 RNA ligase reaction buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 10 or 20 mM of NH4SO4) (NEB), 0.625 ng/µL of purified DNAP ...
-
bioRxiv - Immunology 2022Quote: ... plates were washed 3 times with PBS-T and TMB substrate (Denovo Biolabs) was added for development of color ...
-
bioRxiv - Biophysics 2021Quote: ... in 500 μl T4 ligase buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP and 10 mM DTT, pH 7.5, NEB). Before adding the ligase ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 nM tritiated pSP1 was nicked either using 50 nM Cas12a RNP (WT protein with crRNA 24) at 25°C in Buffer RB for 10 s or using 10 units Nt.BspQI (New England Biolabs) per µg DNA ...
-
bioRxiv - Genomics 2023Quote: ... were mixed in 5 μL of 1x T4 DNA Ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM ATP, 10 mM Dithiothreitol; New England Biolabs) at a final concentration of 80 μM each and annealed by heating at 65 °C for 15 min ...
-
bioRxiv - Systems Biology 2023Quote: ... with 10 µL RT mix (5 µL 5x Maxima RT Buffer, 1.25 µL 10 mM/each dNTP [New England Biolabs #N0447S] ...
-
bioRxiv - Plant Biology 2020Quote: ... Products spanning the open reading frame of each gene were amplified with a high-fidelity Phusion® (NEB) DNA polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... The regular PCR was performed using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs). The PCR products that targeted exon18-10 and exon9-10 were then combined for each sample and run on 2% agarose gel ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR reactions (total 30 μL) included 15 μL PhusionR High-Fidelity PCR Master Mix (New England Biolabs), 0.2 mM primers ...
-
bioRxiv - Genetics 2021Quote: ... PCR reactions were performed with Phusion High Fidelity DNA Polymerase following the manufacturer’s instructions (NEB – New England Biolabs). All primers used in this study are available in Supplementary Table S1.
-
bioRxiv - Molecular Biology 2021Quote: ... genomic DNAs were used as templates in PCR amplification using Phusion High-fidelity DNA Polymerase (New England Biolabs). PCR products were individually treated for 16 h at 37 °C with 20 units of DpnI enzyme (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Captured libraries were re-amplified using Post LM-PCR oligos (Nimblegen) and Q5 High-Fidelity DNA polymerase (NEB) directly from the beads ...