Labshake search
Citations for New England Biolabs :
2751 - 2800 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... PCR was performed using cDNA template and Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Genomics 2020Quote: ... PCR primers were first designed to use Phusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA) to amplify the coding sequence of the desired TGLO and add a T7 promoter to the gene ...
-
bioRxiv - Microbiology 2019Quote: ... For the 16S enrichment we performed a PCR with Q5® High-Fidelity DNA Polymerase (New England Biolabs), the forward primer 341F and the reverse primer 806R to cover the V3/V4 region ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Each 8-sample pool was then Qbit quantified and amplified using Phusion high-fidelity PCR (New England Biolabs) with a PCR primer with one of three unique barcodes ...
-
bioRxiv - Immunology 2019Quote: ... The generated cDNA was used as template for amplification of the emact full transcript using the primer pair Emact_Dw x Emact_Up by high fidelity polymerase chain reaction (Phusion, NEB). Resulting amplicons were sub-cloned into the pDrive cloning vector (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We then used a standard PCR reaction (Table S7; Q5 High Fidelity 2X Master Mix, New England Biolabs) to amplify DNA from an E ...
-
bioRxiv - Microbiology 2019Quote: ... Different mutations were incorporated into the EV-A71 infectious clone plasmid using Q5 high-fidelity DNA polymerase (NEB) PCR site-directed mutagenesis with primers listed in Table S2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The fill-in reaction consisted of a 25 μl Phusion High-Fidelity Master Mix 2X (New England Biolabs), 23 μl of water and 1ul of each oligo at a concentration of 10 μM ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplification was performed using the QUILLS primer set and Q5® High-Fidelity DNA Polymerase (NEB #M0491) as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification was performed in 1X Phusion® High-Fidelity PCR Master Mix with HF Buffer (NEB M0531) and PCR cycling at 98°C for 30s ...
-
bioRxiv - Plant Biology 2021Quote: ... transposed DNA was PCR amplified with 12 cycles using Next High-Fidelity 2×PCR Master Mix (NEB, M0541) with Nextera DNA CD Index primers ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR was carried out under standard conditions using the Q5® High-Fidelity DNA Polymerase (New England Biolabs). Samples were kept at 98 °C for 30 s (1 cycle) ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR reactions for amplicon generation were carried out with Q5 High-Fidelity DNA Polymerase (NEB, cat. no. M0491). pCineo_EGFP_Giant_CT ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Invitrogen Platinum™ SuperFi™ Green PCR Master Mix or Q5® High Fidelity Polymerase (New England Biolabs) were used for generation of backbones from p005 and p006 vectors (appendices ...
-
bioRxiv - Systems Biology 2020Quote: ... The purified transposed DNA was amplified with NEBNext High-Fidelity 2 X PCR Master Mix (New England Biolabs) and custom-designed primers with barcodes.30 Gel electrophoresis was used to remove primer dimers from the PCR products with 2% E-Gel EX Agarose Gels (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: All PCR was performed using 0.02 U/μl Q5® High-Fidelity DNA Polymerase (New England Biolabs, US), 1x Q5® Reaction Buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 100ng of each gDNA sample was PCR amplified in triplicate with Q5 High-Fidelity DNA Polymerase (NEB #M0494S) with 500nM primers (Supplemental table 4 ...
-
bioRxiv - Microbiology 2020Quote: Amplification of adaptor-ligated DNA library was performed using barcoded primers and Phusion high-fidelity DNA polymerase (NEB) for 18 cycles according to provided instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Alternative sgRNA sequences (Supplementary Table S2) were generated by PCR reactions with Q5-High-Fidelity DNA-polymerase (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... was used as template in a pre-amplification reaction by nested primers v2.1-F1 gagggcctatttcccatgattc and v2.1-R1 gttgcgaaaaagaacgttcacgg with 25 cycles and Q5 High-Fidelity DNA Polymerase (NEB), followed by unique barcoded primer combination for pool of all individual 50ul reactions for each genomic DNA sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... Amplification of target regions was performed from 500ng of gDNA using Q5 High-Fidelity 2X Master Mix (NEB) and primers listed in Supplementary Table 1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and ligated with BsmBI-compatible annealed and phosphorylated oligos encoding sgRNAs using high concentration T4 DNA ligase (NEB). All sgRNA sequences used are listed in Supplementary Table 1.
-
bioRxiv - Systems Biology 2022Quote: The gRNA entry vectors were constructed by PCR amplification with Q5 High-Fidelity DNA polymerase (New England Biolabs) of the entire pGG-[B-F]-OsU3-BbsI-ccdB-BbsI-[C-G] plasmids according to the manufacturer’s guidelines ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was performed using 100 ng of genomic DNA and Q5 High-Fidelity Taq Polymerase (New England Biolabs) was used according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... polymerase chain reaction (Q5 High-Fidelity 2x Master Mix and OneTaq, Quick-Load 2X Master Mix, both NEB), PCR clean-up (Monarch PCR and DNA Cleanup Kit ...
-
bioRxiv - Microbiology 2022Quote: ... PCR of a spike gene fragment was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Bioengineering 2022Quote: ... The DNA templates were amplified over 20 cycles using Phusion High-Fidelity DNA Polymerase (New England Biolabs, Inc.). The final concentration of components in a 100 µl PCR reaction was 1ng/µl of DNA template ...
-
bioRxiv - Cell Biology 2022Quote: ... The sequencing libraries were amplified and barcoded with NEBNext® High-Fidelity 2X PCR Master Mix (NEB, M0541S) and size selected with AMPure XP beads (Beckman ...
-
bioRxiv - Cell Biology 2022Quote: ... The sequencing libraries were amplified and barcoded with NEBNext® High-Fidelity 2X PCR Master Mix (NEB, M0541S) and size selected with AMPure XP beads (Beckman ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplification was carried out by using Phusion® High-Fidelity DNA polymerase from New England Biolabs (NEB) on a T100TM Thermal cycler from Bio-Rad and the primer pairs listed in Supplementary Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... the regions of interest were amplified and barcoded using nested PCR with Phusion High-Fidelity DNA Polymerase (NEB), an internal primer containing TSA7 and a footprint sequence ~100-150 nt from the predicted end (oHR542/543/544/545 ...
-
bioRxiv - Microbiology 2021Quote: ... Consistently incomplete assemblies or local ambiguities were solved by PCR amplification using the high-fidelity polymerase Phusion (NEB) followed by Sanger Sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 μl tagmentation product was mixed with 20.4 μl Q5 High-Fidelity 2X Master Mix (NEB, Cat.No. M0492L), 0.4 μl SuperScript II reverse transcriptase ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification was performed using the high-fidelity enzyme Q5 from New England Biolab (NEB, Cat number M0530L) or the Platinum SuperFi DNA polymerase from ThermoFisher (Cat number 123551010 ...
-
bioRxiv - Microbiology 2021Quote: ... For all PCR reactions the Q5 Hot Start High fidelity DNA polymerase was used (New England Biolabs Inc.), according to the manufacturer’s instructions and adapting the elongation time to the size of the amplicon ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR amplification was performed for 15 cycli using the NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541), followed by a 0.8x beads clean-up ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR amplification was performed using the Q5® Hot Start High-Fidelity DNA Polymerase (New England BioLabs Inc.) and the corresponding protocol28 with an annealing temperature of 66°C ...
-
bioRxiv - Microbiology 2022Quote: ... A plasmid encoding T3D S1 in which a T249I mutation had been introduced into σ1 was engineered from the parental reverse genetics plasmid using ‘round the horn PCR (https://openwetware.org/wiki/%27Round-the-horn_site-directed_mutagenesis) with mutagenic primers (sequences available upon request) and Phusion High-Fidelity DNA Polymerase (New England Biolabs). Plasmids encoding rsT3DI segments with silent barcode mutations (Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... PCR-amplified fragments to be used for recombineering were produced with high-fidelity Phusion polymerase (New England Biolabs). Constructs were verified by colony-PCR using Taq polymerase followed by DNA sequencing (performed by Eurofins-GATC Biotech).
-
bioRxiv - Microbiology 2022Quote: ... All PCR reactions for molecular cloning was carried out using Q5® High-Fidelity DNA Polymerase (NEB, M0491) while colony PCR was carried out using Taq Polymerase (NEB ...
-
bioRxiv - Synthetic Biology 2019Quote: ... were combined together by PCR using the Phusion® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA). The resulting fragment was 2.2 kbp was gel-purified ...
-
bioRxiv - Genomics 2019Quote: ... (iii) Polymerase for Ad2 amplification: Libraries #1 and #4 were amplified using Q5 high-fidelity DNA polymerase (NEB). Library #2 was amplified using Pfu Turbo Cx ...
-
bioRxiv - Genomics 2019Quote: ... 2 min at 50ºC and 15 min at 72ºC) using Phusion High-Fidelity PCR Master Mix (New England Biolabs). A biotinylated oligo (Bio NotI-P 5 -P ET ...
-
bioRxiv - Microbiology 2019Quote: ... All the PCR reactions were carried out with Phusion® High-Fidelity PCR Master Mix (New England Biolabs). The libraries generated with TruSeq DNA PCR-Free Sample Preparation Kit were sequenced using paired-end Illumina sequencing (2 × 250 bp ...
-
bioRxiv - Genetics 2019Quote: ... The sgRNA-coding region was amplified by PCR using Q5® Hot Start High-Fidelity DNA Polymerase (NEB) in a reaction volume of 50 μL ...
-
bioRxiv - Synthetic Biology 2019Quote: ... PCR reactions were performed with the Phusion High-Fidelity PCR Master Mix with HF buffer (New England Biolabs). All inserts were verified by sequencing (GENEWIZ) ...
-
bioRxiv - Microbiology 2019Quote: ... primase P4 and a hypothetical gene of joined anacy_RS29550 and anacy_RS29775 were PCR amplified by Phusion High-Fidelity DNA Polymerase (NEB) with specific primers listed in Table S1 ...
-
bioRxiv - Genomics 2020Quote: ... existing vectors were amplified by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) with primers designed to delete the RSINE1 element by site directed mutagenesis ...
-
bioRxiv - Immunology 2020Quote: ... and the assembled plasmid pCO1 was transformed into NEB® 5-alpha competent Escherichia coli (High Efficiency) (NEB) according to manufacturer’s instructions (see Supplementary Figure 1 for plasmid maps) ...
-
bioRxiv - Genomics 2020Quote: ... The final PCR amplification was performed using 2X Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) and final 0.1 μM of PE1.0 and corresponding multiplex PE2.0_MTX (Table S3) ...