Labshake search
Citations for New England Biolabs :
2551 - 2600 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: All fragments for Gibson assembly were amplified using Phusion High-fidelity DNA polymerase (New England Biolabs, USA) with the recommended standard reaction conditions from the supplier ...
-
bioRxiv - Microbiology 2020Quote: ... All PCR products used for sequencing or plasmid synthesis were performed with Q5 high-fidelity polymerase (NEB). The resulting DNA fragment was digested and ligated into NdeI-xhoI digested pET21b(- ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNAs from AAV9-sgRNA infected SCs were amplified using Q5 High-Fidelity 2× Master Mix (NEB). PCR products were purified through QIAQuick PCR purification kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... and then Illumina barcoded and amplified with NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs). A portion of the reaction was performed as a separate qPCR reaction to determine ideal cycle number ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by on-bead 3’RNA adapter ligation using high concentration T4 RNA Ligase I (NEB, #M0204L). IP efficiency was verified by immunoblot of 20% of the IP samples ...
-
bioRxiv - Microbiology 2020Quote: Fragment amplification for constructing remaining plasmids was performed using Q5 high-fidelity DNA polymerase (NEB, Cat. # M0491). A TRL2(Δgfp)-NH fragment was amplified using pTRL2-NH-GrgA as template ...
-
bioRxiv - Microbiology 2020Quote: ... All amplifications were done using Phusion High-Fidelity DNA Polymerase (New England Biolabs UK Ltd., Hitchin, UK). PCR products were purified using a QIAquick PCR Purification Kit (Qiagen UK Ltd. ...
-
bioRxiv - Microbiology 2021Quote: ... All PCR reactions were carried out with Phusion® High-Fidelity PCR Master Mix (New England Biolabs). Mix same volume of 1×loading buffer (contained SYBR green ...
-
bioRxiv - Bioengineering 2021Quote: ... 50 ng input genomic DNA was PCR amplified with Q5 High-Fidelity DNA Polymerase (New England Biolabs): (98 °C ...
-
bioRxiv - Genetics 2020Quote: ... and the FRR1 gene was PCR-amplified with Phusion High-Fidelity DNA Polymerase (NEB, Ipswich MA, USA). PCR products were subjected to gel electrophoresis ...
-
bioRxiv - Microbiology 2019Quote: ... Regular PCR analysis was performed using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs) and detected by the T100™ Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2019Quote: ... All PCR reactions were carried out with Phusion®High-Fidelity PCR Master Mix (New England Biolabs). Mix same volume of 1X loading buffer (contained SYB green ...
-
bioRxiv - Plant Biology 2019Quote: ... All cloning PCR reactions were performed with either Q5® High-Fidelity DNA Polymerase (New England Biolabs) or iProofTM High-Fidelity DNA Polymerase (BioRad Laboratories) ...
-
bioRxiv - Genomics 2021Quote: ... the CMV enhancer/promoter region was amplified from the pcDNA3.0 backbone using Phusion High-Fidelity Polymerase (NEB) and subcloned into the pUC19 vector upstream of the circEfnb2 or circMini backsplicing cassettes ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified/tagged in two steps using NEBnext High-Fidelity 2x PCR master mix (New England Biolabs). Amplified DNA was purified twice with 1.8 volumes of NucleoMag NGS Clean-up and Size Select beads (Macherey Nagel) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... All PCR reactions were carried out with Phusion® High-Fidelity PCR Master Mix (New England Biolabs), and the mixture PCR products were purified with GeneJET Gel Extraction Kit (Thermo Scientific) ...
-
bioRxiv - Evolutionary Biology 2021Quote: Mutagenesis and related PCR reactions were performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs, #M0491). The mutant A3G library was constructed via multi-site saturation mutagenesis of codons 128 and 130 using NNS degenerative codons (N = A ...
-
bioRxiv - Neuroscience 2020Quote: ... of Cas9-CTRL or Cas9-RHO infected retinae using Q5 High-Fidelity DNA Polymerase (New England Biolabs) with primer-F1 ACCTTGGGACAGACAAGCCA and primer-R1 TTTCCGAGGGAAACAGAGGC ...
-
bioRxiv - Plant Biology 2021Quote: ... were amplified by PCR using a Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA). The 4-nucleotide overhangs and the BsaI target sites at 5’ strands at both borders were added by including these sequences in the primers ...
-
bioRxiv - Immunology 2021Quote: ... the scFv containing region from isolated plasmids was amplified by PCR using Q5 high fidelity PCR (NEB). Illumina NGS samples were prepped and run using the Illumina MiSeq v3 reagent kit following manufacturer’s protocols pooling four library samples per lane ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplification was done with Phusion High-Fidelity PCR Master Mix with HF buffer (NEB, MA, USA) and a unique indexed RNA PCR primer (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... The assembled plasmid pCO2 was transformed into NEB® 5-alpha competent Escherichia coli (High Efficiency) (NEB) according to manufacturer’s instructions (see Supplementary Figure 1 for plasmid maps) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and elongation for 7 min at 72°C) using the Phusion High-Fidelity DNA Polymerase (NEB, #M0530S) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... was performed on cDNA using Q5 Hot Start High-Fidelity DNA polymerase (ref. M0493S, New England Biolabs). Amplicons were immediately cleaned up with AMPure XP beads (New England Biolabs ...
-
bioRxiv - Genomics 2021Quote: ... DNA fragments were enriched by PCR using Q5 High-Fidelity 2X Master Mix (New England Biolabs, #M0492S) and sequenced by the Illumina NextSeq 500 system in the Genomics Facility Basel ...
-
bioRxiv - Genetics 2020Quote: ... Each well contained 50 μL of NEBNext High Fidelity 2X PCR Master Mix (New England Biolabs, M0541), 0.5 μL of each primer at 100 μM ...
-
bioRxiv - Developmental Biology 2022Quote: ... oligos were annealed and extended with Bottom strand ultramer_2 using Phusion High-Fidelity PCR Mastermix (NEB, M0531) with Phusion High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Immunology 2022Quote: ... coli (C3019H/C3019I) was transformed with a plasmid DNA using High Efficiency Transformation Protocol (New England Biolabs). After picking a single colony ...
-
bioRxiv - Plant Biology 2022Quote: ... amplifying approximately 225 bp around the cut site using Phusion High Fidelity (New England Biolabs, Ipswich, MA) polymerase ...
-
bioRxiv - Plant Biology 2022Quote: ... LRR-RLPs with no introns were PCR amplified from genomic DNA (Q5 Hot Start High-Fidelity, NEB), all others (Phvul.007g246600 and Vigun07g039700 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... All DNA fragments were amplified using Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs). To construct the C1 module ...
-
bioRxiv - Microbiology 2023Quote: ... coli plasmid DNA were amplified by PCR with Phusion High-Fidelity DNA Polymerase (New England Biolabs, NEB) using primers as indicated in Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR primed with pJ327-pJ328 was performed using Phusion High Fidelity DNA Polymerase (NEB, Ipswich, MA) according to the manufacturer’s protocol on an Applied Biosystems 2720 Thermal Cycler ...
-
bioRxiv - Plant Biology 2022Quote: ... the MpCNL1 (Mp3g01950,1-266aa) and MpCNL1ΔN (Mp3g01950,31-266aa) were cloned by PCR (Q5 High Fidelity Polymerase, NEB) with attL-containing primers using codon optimized gene fragments as a template ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR amplification spanning the gene deletion was achieved using Phusion High-Fidelity DNA Polymerase (New England Biolabs) according to the manufacturers protocol and visualized on 1% agarose gel supplied with ethidium bromide.
-
bioRxiv - Plant Biology 2024Quote: ... the respective promoter was isolated via PCR using Phusion High Fidelity Enzyme (New England Biolabs, no. M0530L) and inserted upstream of GUS gene of pCambia1301 vectors ...
-
bioRxiv - Immunology 2024Quote: ... Immunoglobulin heavy and light chain cDNA was amplified using the Q5 High-Fidelity 2X Master mix (NEB) and pooled forward primers that bind the leader sequences of the variable regions and the reverse primers that bind the first exon of the mu and kappa constant regions ...
-
bioRxiv - Plant Biology 2024Quote: ... and the genes were PCR-amplified using Q5® High-Fidelity 2X Master Mix (New England Biolabs).
-
bioRxiv - Immunology 2023Quote: ... 17 PCR cycles were performed using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, M0532) with primers and template oligo each at a concentration of 10uM ...
-
bioRxiv - Cell Biology 2024Quote: ... wild-type or mutant VPS35L sequences were amplified using Q5 High-Fidelity 2X Master Mix (NEB, M0492) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... All other site-directed mutagenesis was carried out using Q5 High-Fidelity 2X Master Mix (NEB, M0492) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... All PCR reactions followed the manufacturer recommended recipe for Phusion High Fidelity Polymerase (New England BioLabs, Inc.) with these PCR conditions ...
-
bioRxiv - Microbiology 2024Quote: ... Size-selected cDNA was then PCR amplified for 12 cycles using Q5 High-fidelity polymerase (NEB #M0491S). Amplified libraries were then run on a 6% TBE gel ...
-
bioRxiv - Molecular Biology 2024Quote: ... the wildtype 3xFlag-Ptchd1-pcDNA3.1 vector was amplified using Q5 high-fidelity DNA polymerase (NEB; Ipswich, MA), with the forward primer containing the mutant codon of interest ...
-
bioRxiv - Microbiology 2024Quote: LT area was amplified from 12-week gDNA with PCR using Q5 High-Fidelity DNA Polymerase (NEB) and cloned to pUC19 vector to BamHI/HindIII site ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2.5𝜇L of each primer (Where each reaction had non-barcoded primer "Ad1_noMix" and one barcoded primer ’Ad2.1’ - ’Ad2.9’ added) and 25𝜇L NEBNext High-Fidelity 2x PCR Master Mix (NEB) and was run under the following conditions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... France) the amplicon obtained from PCR using Q5 high-fidelity DNA polymerase (#M0491; New England Biolabs NEB) and the primers Salten-pb1-3183-F / Salten-pb1-4136-R primers (TableS1) ...
-
bioRxiv - Microbiology 2024Quote: All PCRs needed for cloning were carried out with high fidelity enzymes Q5 polymerase (New England Biolabs) or Accuzyme (Bioline) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were amplified by PCR with NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs #174M0541S) for 9 cycles in 96-well Thermal cycler (Biorad ...
-
bioRxiv - Bioengineering 2024Quote: ... Amplicons from mouse embryo lysates were generated using Q5 Hot Start High-Fidelity 2x Mastermix (M0492, NEB) in a 25 μL reaction ...