Labshake search
Citations for New England Biolabs :
2801 - 2850 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The U6 cassette from plasmid pDC_A1G2 was amplified using Q5 high fidelity DNA Polymerase (New England BioLabs; NEB) with primers HD104_Cas9UTR_F and HD104_Cas9UTR_R ...
-
bioRxiv - Microbiology 2020Quote: ... The U6 cassette from plasmid pDC_A1G2 was amplified using Q5 high fidelity DNA Polymerase (New England BioLabs; NEB) with primers HD104_Cas9UTR_F and HD104_Cas9UTR_R ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5 μl 10X ligation buffer, 0.8 μl 100% DMSO, 2.5 μl T4 RNA ligase I – high concentration [NEB] ...
-
bioRxiv - Immunology 2020Quote: ... GC-enhancer buffer and 0.25 μl of Q5® Hot Start High-Fidelity DNA Polymerase (NEB, Massachusetts, USA). Amplification was done after an initial phase of denaturation (95 °C ...
-
bioRxiv - Genomics 2019Quote: ... we amplified 20 ng of the library with HSS-pGL4_F and HSS-pGL4_R1 (Supplemental Table 8) using NEBNext High-Fidelity 2X PCR Master Mix (NEB) for 16 cycles ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The PCR reactions were carried out using Phusion High-Fidelity DNA Polymerase and GC buffer (New England Biolabs) in a ProFlex PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 135 ng purified PCR product from the previous reaction and 25 μl Q5 high fidelity master mix (NEB). The thermocycling parameters were ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR for each sample was performed in 50µl total volume: containing 0.5µl Q5 High-Fidelity DNA polymerase (New England Biolabs, USA), 10µl 5X Q5 buffer ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmids were constructed by ligating PCR products amplified with Q5® High-Fidelity DNA polymerase (New England Biolabs) using Golden Gate DNA assembly43 ...
-
bioRxiv - Synthetic Biology 2021Quote: All PCR amplifications for plasmid construction and cloning were performed using Q5® High-Fidelity DNA Polymerase (NEB), followed by purification with Monarch® PCR & DNA Cleanup Kit (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... For all PCR reactions the Q5 Hot Start High fidelity DNA polymerase was used (New England Biolabs Inc.), according to the manufacturer’s instructions and adapting the elongation time to the size of the amplicon ...
-
bioRxiv - Immunology 2019Quote: ... the PCR product was subjected PCR using Q5® Hot Start High-Fidelity 2X Master Mix (NEB; M0494S) in two separate reactions to amplify the KK10 or the KY9 epitope ...
-
bioRxiv - Genetics 2021Quote: ... PCR products destined for cloning were made with Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs).
-
bioRxiv - Genetics 2020Quote: ... Gene amplification was performed using the Phusion High Fidelity PCR Master Mix with HF Buffer (New England Biolabs) and primers KhE5-4 (GACGGTGACACTGTTCATGC ...
-
bioRxiv - Plant Biology 2020Quote: ... Table S1) were used to amplify GmSALT3 cDNA with Phusion® High-Fidelity DNA Polymerase (New England Biolabs) using 35 cycles (98 °C 30 s ...
-
bioRxiv - Cell Biology 2020Quote: ... a semi-quantitative RT-PCR reaction was performed using Q5 Hot Start High-Fidelity DNA polymerase (NEB, M0493S) in a LabCycler thermocycler (SensoQuest) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was conducted in 50-μl volumes using Phusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA). Primers for rpmH (F ...
-
bioRxiv - Microbiology 2021Quote: ... a kanamycin resistance gene flanked by FRT sites was amplified from pFKM1 using Q5 high-fidelity polymerase (NEB) and primers with 75 bp oligonucleotide tails homologous to the sequences up and downstream of the arn operon (KM9H9-F ...
-
bioRxiv - Immunology 2020Quote: ... and amplified by PCR for 11 cycles using NEBNext High Fidelity 2x PCR Master Mix (New England Biolabs). PCR products were purified using a PCR Purification Kit (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... ORF sequences of CatSperτS:WT (phCMV3-CatSpertS:WT) and CatSperτS:Mut (phCMV3-CatSpertS:Mut) were amplified using Q5® Hot Start High-Fidelity 2X Master Mix (NEB) and subcloned into pLenti-CMV-GFP-Hygro (656-4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... σA-FLAG and RbpA-FLAG proteins were prepared by PCR using Q5® High-Fidelity DNA Polymerase (NEB) with primers #3130 + #3131 (HelD) ...
-
bioRxiv - Molecular Biology 2021Quote: Single and double residue substitutions were introduced in Opto-β2AR-2.0 using overlapping oligonucleotides (designed in PrimerX (https://www.bioinformatics.org/primerx/) using the QuikChange option) and circular PCRs with a high-fidelity polymerase (Q5, NEB) followed by digestion with DpnI restriction enzyme (NEB).
-
bioRxiv - Plant Biology 2020Quote: ... PCR fragments used for cloning were obtained using Q5 high-fidelity DNA polymerase (New England Biolabs, Frankfurt, Germany). All PCR-based constructs were sequenced.
-
bioRxiv - Microbiology 2021Quote: ... PCR reactions were carried out with Phusion Hot Start High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA). After digestion with BamH1 ...
-
bioRxiv - Genetics 2021Quote: ... PCR reactions were performed with Phusion High Fidelity DNA Polymerase following the manufacturer’s instructions (NEB – New England Biolabs). All primers used in this study are available in Supplementary Table S1.
-
bioRxiv - Biophysics 2020Quote: ... and dNTPs (0.2 mM each) with ddH2O and 1.0 units of Phusion high-fidelity DNA polymerase (New England Biolabs). Thermocycles included 30 s for initial denaturation at 94 °C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Inverse PCR was performed using NEBNext high-fidelity 2X PCR master mix (New England Biolabs, catalog no. M0541). DNA was purified with SPRISelect beads ...
-
bioRxiv - Immunology 2020Quote: ... The nested PCR assays were run using the NEB enzyme Q5® Hot Start High-Fidelity (NEB, M0491) as follows ...
-
bioRxiv - Microbiology 2020Quote: ... and ligated with BsmBI-compatible annealed and phosphorylated oligos encoding sgRNAs using high concentration T4 DNA ligase (NEB). HIV-1 Gag-Pol and VSV-G plasmid sequences are available upon request.
-
bioRxiv - Microbiology 2021Quote: ... while all other fragments were amplified by PCR using the Q5 HotStart High-Fidelity 2X master mix (NEB). All plasmids were sequence-verified with Sanger sequencing (Macrogen Europe ...
-
bioRxiv - Developmental Biology 2020Quote: ... 16 ng/uL single-stranded pooled oligos were amplified with NEBNext High-Fidelity 2X PCR Master Mix (NEB) with the following PCR protocol ...
-
bioRxiv - Genomics 2021Quote: ... we performed an initial PCR for locus-specific amplicon enrichment using NEBNext 2X High Fidelity PCR MM (NEB) and 5’-biotinylated stub adapter primers specific to appropriate genomic regions to be interrogated (Figure 5-table supplement 1) ...
-
bioRxiv - Genomics 2020Quote: ... the beads resuspended in 20μL EB buffer were used for PCR amplification using 25μl Phusion High-fidelity MasterMix (2X) (New England BioLabs), 4 μl nuclease-free water and 0.5 μl PCRgraftP5 primer (5uM ...
-
bioRxiv - Immunology 2022Quote: ... and subsequently amplified with Nextera sequencing primers and NEB high fidelity 2X PCR master mix (New England Biolabs) for 11 cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... we used three pairs of specific primers (Supplementary Table S2) with Q5 High Fidelity DNA Polymerase (NEB, M0491) or Phusion High Fidelity DNA Polymerase (Thermo Scientific Inc F530S) ...
-
bioRxiv - Immunology 2022Quote: ... and amplified by PCR for 11 cycles using NEBNext High Fidelity 2x PCR Master Mix (New England Biolabs). PCR products were purified using a PCR Purification Kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... The targeted gene region was amplified by PCR (NEB Next High-Fidelity 2xPCR Master Mix; New England Biolabs) using primers listed in Supplementary Table 2 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... followed by a 12-cycle polymerase chain reaction (PCR) using high-fidelity Phusion DNA Polymerase (New England BioLabs). DNA amplification was confirmed using Qubit fluorometry ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplification of the dhodh locus was performed using Phusion High-Fidelity PCR Master Mix (New England BioLabs) as per the protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Synthesized cDNA was used as template in PCR with the Q5 high-fidelity DNA polymerase (New England BioLabs) using intergenic region primers (Table S3 & S4) ...
-
The Arabidopsis MCTP member QUIRKY regulates the formation of the STRUBBELIG receptor kinase complexbioRxiv - Plant Biology 2022Quote: ... PCR fragments used for cloning were obtained using Q5 high-fidelity DNA polymerase (New England Biolabs, Frankfurt, Germany). All PCR-based constructs were sequenced ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed on genes within pDNR207 constructs with Q5 High-Fidelity polymerase (New England Biolabs, Ipswich MA), and all constructs were sequence verified by GeneWiz prior to cloning into binary vectors ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR amplifications were performed using Q5 High-Fidelity DNA polymerase Master Mix 2x from New England Biolabs (NEB). Due to the high GC content of C ...
-
bioRxiv - Plant Biology 2022Quote: ... the At5g20040 transcription unit was amplified from Col-0 cDNA using the Q5 High-Fidelity DNA Polymerase (NEB), as recommended by the manufacturer using the oligonucleotides attB_IPT9_F and attB_IPT9_R ...
-
bioRxiv - Molecular Biology 2022Quote: ... tagmented DNA was PCR amplified using 1x Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB) and 1.25 μM i5 and i7 PCR primers (Nextera® Index Kit (Illumina) ...
-
bioRxiv - Plant Biology 2022Quote: Venus expression constructs were designed in SnapGene (v4.3.11) and generated by integrating PCR-amplified (Q5 hot start high-fidelity, #M0515, New England Biolabs) DNA fragments into plasmid pODC53 (Caspari ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Microbiology 2024Quote: Polymerase chain reactions (PCRs) for cloning purposes were performed using the high fidelity Phusion DNA Polymerase (NEB, France). PCR products were purified with the NucleoSpin PCR Clean Up kit (Macherey Nagel ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR fragments used for cloning were obtained using Q5 high-fidelity DNA polymerase (New England Biolabs, Frankfurt, Germany). All PCR-based constructs were sequenced ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA lysate was used as genotyping PCR template with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) and enhancer specific genotyping primer pair spanning the upstream and downstream Cas9-guide RNA cleavage sites (Table S19) ...