Labshake search
Citations for New England Biolabs :
2401 - 2450 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... Purified plasmids were first amplified and linearized using Q5 Hot Start High-Fidelity DNA Polymerase (NEB); forward and reverse primers are listed in Table S5 ...
-
bioRxiv - Genomics 2024Quote: ... Libraries were amplified for 12 cycles using NEBNext® High-Fidelity 2X PCR Master Mix (NEB) in total volume of 25µl in the presence of 800nM of barcoded primers (400nM each ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Reverse: acctgaggagtgaattcacgcgttcactggcgacgccac) with Q5® Hot Start High-Fidelity master mix (Cat.#M0494, New England Biolabs) and purified by DNA gel electrophoresis ...
-
bioRxiv - Microbiology 2024Quote: ... two inverse PCRs were carried out using R3-p21 as a template and oligonucleotides Trip.A.For/Trip.A.Rev and Trip.B.For/Trip.B.Rev (Supplementary Table 1) using Phusion High-Fidelity DNA Polymerase (New England BioLabs) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... a Taq polymerase with proof reading activity was used (e.g. Phusion High Fidelity DNA polymerase, NEB). PCR products were separated on a 1–3 % TBE agarose gel.
-
bioRxiv - Microbiology 2024Quote: ... The vector backbone and insert fragments were amplified with Q5 high-fidelity DNA polymerase (M0491L, NEB) and ligated together with the ClonExpress® Ultra One Step Cloning Kit (C112-02 ...
-
bioRxiv - Genetics 2024Quote: ... and libraries were generated by PCR with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541). Prior to sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... The cDNA was then amplified with Phusion High-Fidelity DNA Polymerase (New England Biolabs, catalog #M0530S) using the following steps ...
-
bioRxiv - Microbiology 2023Quote: ... and the DNA library preparation was performed using Q5 high-fidelity DNA polymerase (New England Biolabs). Peak-calling was performed as previously described [65].
-
bioRxiv - Synthetic Biology 2024Quote: All PCRs were carried out using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB), gel extractions using the QIAquick Gel Extraction Kit (QIAGEN ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCRs were carried out using the Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) in a total volume of 20ul ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA libraries underwent PCR amplification (NEB-Next High-Fidelity 2x PCR Master Mix, New England Biolabs), indexing using previously described primers (Buenrostro et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... after which the library amplification was one with Phusion High-Fidelity DNA Polymerase (New England Biolabs) during which the Illumina adapters were introduced ...
-
bioRxiv - Immunology 2024Quote: ... DNA was then amplified using NEBNext High Fidelity 2X PCR Master Mix (New England Biolabs, #M0541S) for 5 cycles ...
-
bioRxiv - Bioengineering 2024Quote: ... comprising 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA), 0.2 μM of forward and reverse primers ...
-
bioRxiv - Bioengineering 2024Quote: All polymerase chain reactions were performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs) and all primers were synthesized by IDT (Integrated DNA Technologies) ...
-
bioRxiv - Cancer Biology 2024Quote: ... ATAC-seq libraries were prepared using the NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541) as previously described76 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we amplified the oligos for each tile (Q5 Hot Start High-Fidelity 2X Master Mix, NEB). In parallel ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR replication of Geneblocks was conducted using Q5® Hot Start High-Fidelity Master Mix (NEB; as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Phage DNA was subjected to two rounds of PCR using Q5 High-Fidelity 2X Mastermix (NEB), as previously described (Garrett et al. ...
-
bioRxiv - Genetics 2023Quote: ... and ligated into pWS1728 (BsrGI and AflII digested) using high concentration T4 DNA ligase (NEB M0202T). Ligations were transformed into DH5⍺ E ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... Each variant was amplified with primers PK421&422 using Q5 High-Fidelity 2X Master Mix (NEB) in a 200 µl reaction followed by DpnI digestion for 2 h ...
-
bioRxiv - Immunology 2023Quote: ... and 100-200ng were PCR amplified using Q5 Hot Start High Fidelity 2x Master Mix (NEB) and 10µM forward/reverse primers flanking the region of interest ...
-
bioRxiv - Genetics 2023Quote: ... PCR was performed on genomic DNA by using Q5 High-Fidelity Taq Polymerase (New England Biolabs) followed by T7 endonuclease I assay (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Half the cDNA was subjected to 2nd strand synthesis using Phusion high-fidelity DNA polymerase (NEB) with primers to the 5’ RNA linker and reverse adaptor (5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’ and 5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3’ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we used Phusion® High-Fidelity DNA Polymerase (M0530L, New England Biolabs, Ipswich, Massachusetts, United States) with the following conditions:
-
bioRxiv - Cell Biology 2023Quote: ... ORFs for each construct were amplified using Q5 Hot Start High-Fidelity 2X Master Mix (NEB) and subcloned into linear vectors using NEBuilder HiFi DNA Assembly Kit (NEB)
-
bioRxiv - Plant Biology 2023Quote: ... PCR amplification of purified DNA was done using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The integrity of the purified raspberry DNA was demonstrated by amplification of a 325nt portion of the EIF 2.1 gene using primers 1468(F ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR reaction was performed using NEBNext High Fidelity PCR Master Mix (NEB, catalog no. M0541L) for 20 cycles ...
-
bioRxiv - Genetics 2023Quote: ... the 10XUAS-DSCP promoter was amplified from plasmid pNP with Q5 High-Fidelity DNA Polymerase (NEB) using primers UP0394 and UP0395 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The eluted transposed DNA was submitted to PCR using Q5 High-Fidelity Polymerase (New England Biolabs). DNA was amplified with 7 cycles of PCR ...
-
bioRxiv - Genetics 2023Quote: ... All PCR amplifications were done using Q5® High-Fidelity DNA Polymerase (New England Biolabs, UK) following manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and library amplification was performed using NEBNext® High-Fidelity 2X PCR Master Mix (M0541L-NEB) with Nextera Ad1_noMX and Ad2.X primers ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... Template DNAs were prepared by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (NEB) with the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Library was PCR amplified for 5 cycles using the NEBNext High-Fidelity MasterMix (New England BioLabs) followed by qPCR amplification to determine the exact number of additional cycles required for optimal library amplification ...
-
bioRxiv - Biochemistry 2023Quote: PCR mutagenesis was performed by whole plasmid PCR with Q5 high-fidelity polymerase (New England Biolabs) followed by PCR purification (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: The Gr64f promoter was PCR amplified using Q5 High-Fidelity 2× Master Mix (New England Biolabs) from the Gr64f-GAL4 (107 ...
-
bioRxiv - Cell Biology 2022Quote: ... which involved fragment amplification with the Q5 high-fidelity DNA polymerase (NEB #M0494S, Ipswich, MA, USA), DpnI digestion (NEB #R0176S) ...
-
bioRxiv - Biophysics 2022Quote: ... The PCR1 reactions were run using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Barcodes were amplified from the library using Q5 High-Fidelity 2X Master Mix (Q5, NEB #M0492) using primers GWLP P2-3 with 20 cycles ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 μL 25μM P5 adapter and 25 μL NEBNext High-Fidelity 2x PCR Master Mix (NEB). Transposed DNA was amplified for 5 min at 72°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Each PCR consisted of: 20 μL Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 1 μL 10 μM forward primer ...
-
bioRxiv - Biochemistry 2023Quote: ... the following was mixed: 20 μL Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 2 μL 10 μM i5 indexing adapter ...
-
bioRxiv - Cell Biology 2023Quote: ... and fragments were generated by polymerase chain reaction (PCR) using Phusion High-Fidelity Polymerase (M0530L, NEB) using 35 cycles and 60°C annealing temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated into BsmBI- digested and dephosphorylated pUSEPR vector using high-concentration T4 DNA ligase (NEB). Ligated pUSEPR plasmid DNA was electroporated into Endura electrocompetent cells (Lucigen) ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was amplified for 30 cycles by adding 0.5ul Phusion High Fidelity DNA Polymerase (NEB; M0530S), 10ul of 5X Phusion HF Buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... Full-length ORFs were amplified with Phusion® High-Fidelity DNA Polymerase (NEB, Ipswich, MA, USA) using gene-specific primer pairs (Supplementary Table 2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR was performed on genomic DNA by using Q5 High-Fidelity Taq Polymerase (New England Biolabs) followed by T7 endonuclease I assay (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... and late SV40 pA signal) were generated using Q5 High-Fidelity DNA Polymerase (NEB, Ipswich, MA) from sequence-confirmed TOPO plasmids ...
-
bioRxiv - Immunology 2023Quote: ... All cloning PCR amplifications were performed using the Q5 High-Fidelity DNA Polymerase (New England Biolabs) according to standard procedures ...