Labshake search
Citations for New England Biolabs :
1501 - 1550 of 2232 citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... All plasmids used in this study were constructed using either Q5 Site Directed Mutagenesis Kit (New England Biolabs, E0554S) or In-Fusion HD Cloning Plus (Clonetech ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid backbone, pFA6 (Janke et al., 2004) was digested using the restriction enzymes SacII (#R0157S, New England Biolabs) and HindIII (#R3104T ...
-
bioRxiv - Microbiology 2021Quote: ... Transformants positive for each Cas9HygAMA-sgRNA plasmid were screened by colony PCR using Taq DNA polymerase (New England Biolabs) with the forward Cas9HygAMAccdB primer (MR139 ...
-
bioRxiv - Immunology 2020Quote: The following plasmids used in this study have been previously described: pEF-Tak-Flag (52) and pCMV-Gluc2 (NEB). The following plasmids were generated in this study:
-
bioRxiv - Microbiology 2021Quote: ... was amplified from RH genomic DNA and cloned into the pTKO2-HPT-3xHA plasmid (44) using Gibson Assembly (NEB).
-
bioRxiv - Biophysics 2021Quote: ... The EGFR-mApple and EGFR-mEGFP plasmids were digested with AgeI (AgeI-HF, R3552S, New England BioLabs, Massachusetts, USA) and SpeI (SpeI-HF ...
-
bioRxiv - Synthetic Biology 2022Quote: PCR-amplified parts of DNA were assembled using Golden Gate Assembly and inserted into plasmid backbones (New England Biolabs).49 The T7 driven gene circuits for fusion protein expression were inserted into vector PBS1C,50 which carries homology sites of amyE locus and a chloramphenicol resistance selection marker ...
-
bioRxiv - Genetics 2022Quote: ... the sgRNA sequences were inserted into the pBSMVγPDS plasmid after removing the PDS fragment by PacI and NotI digestion (New England BioLabs, Ipswich ...
-
bioRxiv - Genetics 2022Quote: ... The digested PCR products and the pBSMVγ plasmid were ligated using T4 ligase (New England BioLabs, catalog number M0202). This plasmid was named pBSMVγQT1 (Figure 1b) ...
-
bioRxiv - Microbiology 2022Quote: ... and the fucI PCR product was cloned into the plasmid using the NEBuilder HiFi DNA Assembly Kit (NEB; E5520S), followed by transformation into the E ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was then transcribed from the NsiI-linearised plasmids with the HiScribe™ T7 ARCA mRNA Kit (NEB E2065S) or HiScribe™ T7 mRNA Kit with CleanCap® Reagent AG (NEB E2080S ...
-
bioRxiv - Plant Biology 2019Quote: ... Plasmids used in this study were linearised by digestion using the appropriate restriction enzymes (New England Biolabs, Hitchin, UK). All DNA constructs were verified by sequencing (Source Bioscience).
-
bioRxiv - Biochemistry 2019Quote: To generate the plasmid pIL-SVnisT the nisT gene from pNZ-SV10HnisT was amplified by Phusion DNA polymerase (NEB) with the primer pair infupIL-SVfor and infupIL-SVrev (Supplementary File 4 ...
-
bioRxiv - Microbiology 2019Quote: ... all restriction enzyme digested plasmids were treated with Calf Intestinal Alkaline Phosphatase (New England Biolabs, Inc., Cat. No. M0290S) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... as per the manufacturers protocol and co-transformed into CEN.PK2-1C with pRS425 episomal plasmid backbone digested with SfoI and SacI (NEB). The assembled plasmid was extracted from S ...
-
bioRxiv - Immunology 2020Quote: ... The ligated plasmids pAF217 and pAF218 were then transformed into NEB® Stable Competent Escherichia coli (High Efficiency) (NEB). Single colonies were selected ...
-
bioRxiv - Molecular Biology 2019Quote: All plasmids were linearized with NotI and transcribed in vitro using the HiScribe(tm) T7 ARCA mRNA kit (NEB). mRNA was purified using the RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was performed on 4 ng of pKD3 plasmid using Q5 High-Fidelity 2X Master Mix (New England Biolabs). The PCR product was digested for 1 hour with the restriction enzymes DpnI and ClaI at 37°C and then the PCR product was run on a 1% agarose gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... all sequences between transposable elements of a p2T plasmid were removed by restriction digestion using AleI and EcoRI (NEB). The TetO-eGFP-HygroR cassette was created by amplifying each subunit individually from already excising constructs ...
-
bioRxiv - Cell Biology 2020Quote: ... Duplexed ultramers were diluted 1:100 in molecular biology grade water and ligated to digested plasmid using NEBuilder HiFi DNA assembly master mix as per manufacturer’s instructions (New England BioLabs). Plasmids were transfected into NEB5α bacteria and verified by Sanger sequencing.
-
bioRxiv - Synthetic Biology 2021Quote: ... To this end pCANTAB6_VhhTD4 plasmid (Supplementary Fig. S2) was used as DNA template for PCR using Q5 DNA polymerase (NEB) in three different reactions each containing the oligos 1 and 2 (for H107Y) ...
-
bioRxiv - Genomics 2019Quote: ... We then cloned all three libraries into the pGL4.23c plasmid using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB), following the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: All plasmids used in this study were assembled by USER™ (uracil-specific excision reagent) cloning (New England Biolabs). Biobricks constituting promoters ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We engineered the Thrβ119Ser substitution by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in 1× Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Cell Biology 2019Quote: ... The GFP-Rab5C PCR product and a pLXIN-I-NeoR plasmid were digested using Hpa1 (New England Biolabs – R0105) and Not1 (New England Biolabs – R3189 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... From the resulting plasmid a fragment containing CRE-bGH-poly(A) was excised with restriction enzymes SalI (NEB, R3138S) and AleI (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5 μg of 32P-labelled R-loop-containing plasmid was either mock-treated or incubated with 0.5 U RNase H (NEB) in 75 mM KCl / 50 mM Tris-HCl pH 7.5 / 3 mM MgCl2 / 10 mM DTT in a 20 μL reaction volume for 30 minutes at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The transcription template for RNAI was produced by using p770 plasmid (from E. coli strain LK_2385) as template for PCR amplification using Q5 polymerase (NEB) and LK_3413 and LK_3414 primers to introduce a T7 class II promoter (Supplementary table 3) ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA was first cut by mixing the plasmid with a 10x digestion buffer (NEBuffer; Biolabs; Ipswich, MA, USA), a 10x EcoRI restriction enzyme (Biolabs) ...
-
bioRxiv - Biochemistry 2020Quote: ... PfPPRD-HA-TetR-DOZI and PfPPRD-TetR-DOZI plasmids were linearized with EcoRV (New England BioLabs, Ipswich, MA, USA). The RNA guide (gRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10-20 μg plasmid DNA was incubated with SssI (2.5 U/μg plasmid DNA) in the presence of 160 μM S-adenosylmethionine (SAM; New England Biolabs) for four hours at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... The products of the HiFi reaction were transformed into either NEB10β (for chlamydial transformation plasmids) or NEB5αIq (for BACTH) competent cells (NEB) and plated on appropriate antibiotics ...
-
bioRxiv - Molecular Biology 2020Quote: ... we cloned the eGFP plasmid by restricting the pEGFP-RNASEH2A using HincII (New England Biolabs, Radnor, PA, cat # R0103S) that cut upstream and downstream of the RNASEH2A gene but leaves the EGFP intact ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR product was integrated into the plasmid via the Gibson Assembly cloning system (New England Biolabs-NEB). The pSG1164 plasmid integrates at the native locus of the corresponding gene by a single-crossover event ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR product was integrated into the plasmid via the Gibson Assembly cloning system (New England Biolabs-NEB). The pSG1164 plasmid integrates at the native locus of the corresponding gene by a single-crossover event ...
-
bioRxiv - Biophysics 2022Quote: ... and inserted to desired positions into the pCDNA.3.1-mPIEZO1 plasmid using High-Fidelity DNA Assembly (New England Biolabs). The presence of cpGFP inserts was confirmed by Sanger sequencing (GENEWIZ) ...
-
bioRxiv - Biophysics 2022Quote: ... Both RBPs presented (PCP and QCP) were cloned into the RBP plasmid between restriction sites KpnI and AgeI (NEB, catalog ...
-
bioRxiv - Molecular Biology 2022Quote: ... The new construct was created from a PCR reaction that amplified the entire plasmid harbouring the substitution using the high-fidelity polymerase Q5 according to the manufacturer’s instructions (New England Biolabs; NEB). The unpurified PCR product was then treated with DpnI to digest the methylated template DNA which was subsequently transformed into DH5α ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Genetics 2022Quote: All of the plasmids created by Gibson assembly used the NEBuilder HiFi DNA Assembly kit (New England Biolabs, #E2621). To construct the URA3 RRM3 plasmid ...
-
bioRxiv - Microbiology 2022Quote: ... The nrVL4619 genome was excised and separated from its plasmid backbone using BsaI-HFv2 (New England Biolabs catalog # R3733) and PvuI-HF restriction enzymes (New England Biolabs catalog # R3150) ...
-
bioRxiv - Microbiology 2022Quote: ... The ligation of the digested insert into the recipient plasmid was performed using T4 DNA ligase (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... All plasmids (Table S4) were constructed using the Gibson isothermal assembly method (NEBuilder HiFi DNA assembly master mix, NEB) and electrotransformed into E ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA fragments were inserted into plasmid vectors using NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, Massachusetts, USA). The primers used in this study are listed in the Supplemental Table S9 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pCMV-PE4max with MluI restriction site and the pLV-PE plasmid were both digested by MluI (NEB #R0198L) and NotI (NEB #R0189L) ...
-
bioRxiv - Physiology 2022Quote: ... The scAAV-CMV-GFP plasmid was digested with EcoRI and HpaI (New England Biolabs; Cat. Nos. R3101 and R0105) and the linearized scAAV-CMV plasmid without the GFP was gel purified ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant plasmids encoding a catalytically inactive 3Dpol (3Dneg) were generated using the Q5 Site-Directed Mutagenesis Kit (NEB, E0554S). Nucleotides at position 6891 and 6892 of the CVB3/28 genome were mutated from AT to GC ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmids were constructed using the NEBuilder HiFi DNA assembly strategy of New England Biolabs (NEB, Frankfurt am Main, Germany)55 ...