Labshake search
Citations for New England Biolabs :
6151 - 6200 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... palustris RCB100 was used as a template for PCR amplification using Phusion High-Fidelity DNA polymerase(New England Biolabs) with primers aliAF and badKR (Table S2) ...
-
bioRxiv - Neuroscience 2023Quote: ... Both UB K48R and UB K63R PCR inserts were digested with Nde1-HF and NotI-HF (New England Biolabs), ligated into the pET28a vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... the circular fragments were amplified by two rounds of polymerase chain reaction (PCR) with Q5-High Fidelity polymerase (NEB). Both PCR rounds begin with an initial denaturation at 98 °C for 30 s ...
-
bioRxiv - Genomics 2023Quote: ... Final immunoprecipitated DNA samples from the kit were then purified using a Monarch PCR and DNA cleanup kit (5μg) (NEB), with a final elution volume of 50μL in TE buffer ...
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... The quantitative PCR reaction mix contained 5 µl of the Luna Universal qPCR Master Mix (2X, New England BioLabs), 1 µl of the forward primer (10 µM) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the region of interest was minimally amplified through a 7-cycle PCR (Phusion® High-Fidelity DNA Polymerase, NEB) surrounding the mtDNA regions for ddPCR detection ...
-
bioRxiv - Genetics 2023Quote: The coding region of cDNA clone FI18815 was PCR amplified and cloned in frame into pENTR4 (HiFi assembly, NEB) and then into pPHW using Clonase (Life Tech.) ...
-
bioRxiv - Genetics 2023Quote: ... Barcodes were amplified by PCR (CP21.P14: TCCTCATCCTCTCCCACATC, CP17.P12: GGACGAGGCAAGCTAAACAG, NEB Q5 for 20 cycles, Tm 67 °C). We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles ...
-
bioRxiv - Neuroscience 2023Quote: ... The region of interest was amplified using Phusion® High-Fidelity PCR Kit (New England Biolabs, Cat. No. E0553S). The PCR product was purified with QIAquick PCR Purification Kit (Qiagen ...
-
bioRxiv - Systems Biology 2023Quote: ... Sfp1 mutations were carried out by site-directed mutagenesis with PCR amplification using Q5 & Phusion polymerases (New England Biolabs). For plasmids pLV30 (sfp1Zn1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and PCR enrichment were performed sequentially using the NEBNext Ultra™ II DNA Library Prep Kit for Illumina (NEB). Lastly ...
-
bioRxiv - Genomics 2024Quote: ... to the PCR-amplified pDR111 (using P3 and P4) using the HiFi DNA assembly protocol (New England Biolabs, USA). This resulted in the cloning of the mutL* polC* synthetic operon under the control of Phs into a B ...
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding amino acid residues 1 to 35 of the N-terminal end of BVG96_RS17270 (89) was PCR amplified using Q5 polymerase (NEB) and cloned via NEBuilder HiFi DNA Assembly (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... and menA were amplified by PCR from the IR715 genome using Q5 High Fidelity Master Mix (New England Biolabs). PCR products were purified using the QIAEX II Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Genomics 2023Quote: ... Ten-fold diluted cDNA was used in qRT-PCR using Luna Universal qPCR Master Mix (New England Biolabs #M3003E) in a final 10 µL reaction in QuantStudio 3 Real-Time PCR machine (Thermo Fisher Scientific) ...
-
Understanding Campylobacter coli isolates from the Vietnamese meat production network; a pilot studybioRxiv - Microbiology 2023Quote: ... manufacturer recommended PCR conditions were used with eight minutes amplification using NEB LongAmp Taq 2X Master Mix (NEB M0287). DNA end repair was performed using NEBNext Ultra II End repair/dA-tailing Module (E7546) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Unmethylated linear DNA was generated by PCR using NEB’s Q5 HotStart High-Fidelity 2x Master Mix (NEB CN# M0494S) from plasmid extracted from E ...
-
bioRxiv - Microbiology 2024Quote: ... the promoter regions of dotA (490 bp upstream dotA_RS21140 and dotDCB (intergenic region of 921 bp between dotD_RS21055 and RS21050 genes) were PCR-amplified using a high-fidelity polymerase (Phusion, NEB) and PCR products were purified before cloning (QIAquick PCR purification kit ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were purified with DNA Spin and Concentrate kit (Zymo Research, Irvine, CA, D4013 or NEB Monarch, T1030) following manufacturer instructions or gel-purified from kit (Zymo Research) ...
-
bioRxiv - Genomics 2024Quote: ... IVT was performed on the purified PCR product using a HiScribe T7 High yield RNA Synthesis Kit (NEB, E2040S) and purified using a Monarch RNA Cleanup Kit (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... and PCR enrichment were performed sequentially using the NEBNext Ultra™ II DNA Library Prep Kit for Illumina (NEB). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Chromosomal integration of fluorescent tags was confirmed by colony PCR (touchdown protocol) using Q5 HF Master mix (NEB, USA). The primer pair Fwd_full series_Tn7 with Rev_Tn5/7_gt were used to confirm the integration of fluorescent tags ...
-
bioRxiv - Systems Biology 2024Quote: ... Vectors were digested using restriction enzymes (EcoRI and BamHI) and PCR fragments were amplified using Q5 DNA polymerase (NEB). NES-APEX2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR fragments were cloned into psiCHECK-2 using the restriction enzymes XhoI/NotI or SglI/NOTI (New England Biolabs). Ligations were performed with a quick ligation kig (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... dsDNA donor molecules with ∼40 bp homology arms were prepared by PCR using Q5 DNA Polymerase (New England BioLabs) and purified using HighPrep PCR Clean-up beads (MagBio ...
-
bioRxiv - Molecular Biology 2024Quote: ... The four PCR products were then assembled in a 1:1:1:1 ratio using HiFi assembly (NEB, E5520S) according to the manufacturer’s instructions to create the pLenti-STARR vector (pAS5018) ...
-
bioRxiv - Bioengineering 2024Quote: ... The two obtained PCR fragments were assembled by NEBuilder® HiFi DNA Assembly Master Mix (E2621, New England BioLabs) into a pET28a backbone generated by PCR with primers 13 and 14 ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmid pEGFP-C1 was used as a template in a PCR reaction using Q5 DNA polymerase (New England Biolabs) and oligonucleotides (5’-ACGCGTAAATTGTAAGCG-3’ and 5’-AACAACAACAATTGCATTCATTTTATG-3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... The following PCR mixture was prepared for both preliminary and preparative PCR: Hot Start Taq DNA polymerase (2.75 U, New England Biolabs), 1X Hot Start Taq reaction buffer ...
-
bioRxiv - Microbiology 2024Quote: ... PCR enrichment of adaptor-ligated DNA was conducted with five cycles using NEBNext Multiplex Oligos for Illumina (NEB, USA) for paired-end barcoding ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 rounds of PCR were run using Q5® Hot Start High-Fidelity 2X Master Mix (NEB cat #M0494) following the manufacturer’s instructions with a 63°C annealing temperature and 30s extension ...
-
bioRxiv - Microbiology 2024Quote: ... Flanking regions of 1 kb on either side of the target gene were PCR amplified using Q5 polymerase (NEB) and cloned into pLGB13 using the NEBuilder HiFi cloning kit (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... Both PCR reactions used 0.02U/L Q5 Hot Start high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, USA) with 200M dNTPs and 0.5M forward and reverse primers in 1M Q5 reaction buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... OSCA1.2 pIRES2-mCherry vector and the BLD of OSCA3.1 were separately amplified by PCR using Q5 High-Fidelity 2X Master Mix (NEB), followed by fragment assembly using Gibson Assembly Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... To ensure this we performed the Oligonucleotide Clean-up protocol of the Monarch PCR & DNA Clean-up kit (NEB) on 10 PCR reaction tubes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... compatible overhangs for ligation were generated by digestion of PCR products using 5 units each of BsaI (NEB, R3733S) and DpnI (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The linear template for in vitro transcription (IVT) was generated via PCR using Q5 DNA Polymerase (New England Biolabs) with the forward primer (5’-AGCTATAATACGACTCACTATAAGctcctgggcaacgtgctg-3’ ...
-
bioRxiv - Plant Biology 2020Quote: ... The DNA fragments used for gene fusion and cloning in the final constructs were amplified by PCR using Q5 DNA polymerase (New England Biolabs) using standard conditions ...
-
bioRxiv - Plant Biology 2020Quote: ... APE1 gene with an additional 1500 bp on the 5’ side and 500 bp on the 3’ side was amplified by PCR using Q5 High-Fidelity DNA Polymerase (NEB) using primers 5’-TTATAATACCCACCCGTCAAAGCTGTG-3’ and 5’-TTATAACAGACTCATCCGGACCCCAA-3’ containing an additional PsiI restriction site (70°C ...
-
bioRxiv - Microbiology 2020Quote: ... Illumina sample-specific barcodes and sequencing adapters were added in a final PCR reaction consisting of (per sample) 10 μl 2x Hot Start Taq master mix (New England BioLabs), 2 μl each of Nextera N7 and S5 barcoding primers (Illumina) ...
-
bioRxiv - Biophysics 2021Quote: The DNA substrate used in the optical trapping assay was a ~3400-bp PCR-amplified section of plasmid PBR322 (New England Biolabs). The forward primer (5’-/btn/-ACA GCA TCG CCA GTC ACT AT-3’ ...
-
bioRxiv - Biophysics 2021Quote: ... traAB fragments were PCR amplified and then ligated into pMR3487 (linearized with XbaI and KpnI) through Gibson Assembly (New England Biolabs). To create pPC59 ...
-
bioRxiv - Biophysics 2020Quote: ... The PCR was typically performed in 10 x 50 µL volume by mixing in PCR tubes Phusion HF buffer (1x, New England Biolabs), plasmid template (0.02 ng/µL) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PCR products were resolved by agarose gel electrophoresis and purified using the Monarch Gel Extraction kit (New England Biolabs). Purified PCR products were Sanger sequenced by Genewiz using the BPNT1_F_Seq primer ...
-
bioRxiv - Microbiology 2020Quote: ... 1µL supernatant was then used as template for the first round of arbitrary PCR: a 20µL total volume Q5® Hot Start polymerase reaction (New England Biolabs) with 2.5pmol oALA051 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lipidation-deficient LC3B proteins were generated by mutagenic PCR using Q5 Hot Start High-Fidelity Master Mix (New England Biolabs) to introduce the GGG to GCT change that leads to a glycine to alanine (G120A ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP and AID were amplified via PCR and assembled via Gibson cloning (using the Gibson Assembly Master Mix, cat# E2611, NEB). The resulting plasmid was sequenced thoroughly ...
-
bioRxiv - Cell Biology 2020Quote: ... The PCR fragments were cloned into the linearized pUC19 vector using the Gibson Assembly Cloning Kit (E5510S; New England Biolabs).
-
bioRxiv - Cell Biology 2020Quote: ... an ORF encoding CHM7-3xHA-GFP was PCR amplified from genomic DNA isolated from DTCPL1240 and assembled into pRS406-GAL1 digested with EcoRI/XbaI (New England BioLabs) using the Gibson Assembly Master Mix (New England BioLabs).
-
bioRxiv - Cell Biology 2020Quote: ... Qualitative PCR was set up in 200 μl PCR-SoftTubes (Biozym Scientific GmbH, Hessisch Oldendorf, Germany) using Q5 High-Fidelity DNA Polymerase (New England Biolabs (NEB), Frankfurt am Main ...