Labshake search
Citations for Illumina :
1 - 50 of 418 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... 25 mL of 2x NEBNext Ultra II Q5 Master Mix, 3 mL of 10 mM Universal PCR primer from Illumina, 3 mL of 10mM Index PCR primer and 9 mL of nuclease-free water and amplified for 10 cycles (98C for 10 s ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were resuspended in cold PBS and tagmentation master mix (25 ul of 2x tagmentation buffer, 2.5 ul of TDE1 [Illumina] ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR master mix containing NPM PCR mix (Illumina), 1X SYBR Green dye and uniquely indexed PCR primers were added to each well ...
-
bioRxiv - Genetics 2023Quote: ... dsODN specific PCR products were used for indexing PCR using 2x Platinum SuperFi PCR Master mix and i5 primer: AATGATACGGCGACCACCGAGATC and i7 indexing primers (Illumina) following the cycling conditions ...
-
bioRxiv - Immunology 2021Quote: ... Transposed DNA fragments were purified using Qiagen Mini- Elute Kit and PCR amplified using NEB Next High Fidelity 2x PCR master mix (New England Labs) with dual indexes primers (Illumina Nextera). Genomic Alignment of sequencing reads ...
-
bioRxiv - Genomics 2021Quote: ... 30 μL of NEBNext Ultra II Ligation Master Mix, 1 μL of NEBNext Ligation Enhancer, 2.5 μL of NEBNext Adapter for Illumina) at 20 °C for 15 min. ...
-
bioRxiv - Genomics 2023Quote: ... 12.5 μl of a master mix containing 7.5 μl of Nextera PCR Master Mix (Illumina, FC-131-1096) and 2.5μl of each Index primer i7 (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... 25 μl PCR master mix (Nextera, Illumina) and 5 μl indexed amplification primers59 (0.125 μM final concentration ...
-
bioRxiv - Immunology 2020Quote: ... The transposase reaction mix (2x transposase buffer, TDE1 enzyme (both from Illumina), 0.01% Digitonin (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were resuspended in transposition mix (25 µL 2x TD buffer (Illumina), 16.5 µL PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were resuspended in transposition mix (25 µL 2x TD buffer (Illumina), 16.5 µL PBS ...
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Pelleted nuclei were resuspended in 25μL Transposition mix (12.5μL 2x TD buffer (Illumina), 1.25μL transposase (100nM final ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 μl of transposition mix (7.5 μl 2X TD Buffer (Illumina, FC-121-1030), 2.05 μl 1X PBS ...
-
bioRxiv - Microbiology 2019Quote: ... 10 ng of DNA template was combined with PCR master mix (0.2 mM dNTP mix, 0.56 mg/ml BSA, 0.4 uM Illumina adapter sequence-tagged forward primer (515F ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nuclei pellets were resuspended gently in transposition reaction mix (25 µL 2X TD Buffer [Illumina Cat #FC-121-1030] ...
-
bioRxiv - Developmental Biology 2022Quote: ... The samples were then resuspended in 1 ml of ATAC mix (2X TDE buffer (Illumina), 50 µl TDE (Illumina) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The transposition reaction mix (25 μl 2X TD buffer, 2.5 μl TDE1 Nextera transposase (Illumina), 16.5 μl PBS ...
-
bioRxiv - Genomics 2023Quote: ... and pellets were resuspended in the transposition reaction mix (25 µL 2X TD buffer (Illumina), 2.5 µL TDE1 Tn5 transposase (Illumina) ...
-
bioRxiv - Bioengineering 2020Quote: ... Pelleted nuclei were resuspended in 25 μL Tn5 transposition mix (12.5 μL 2X Tagment DNA buffer, 1.25 μL Tn5 transposase, and 11.25 μL sterile water; Illumina) and stored in a shaking incubator at 37°C and 500 RPM for one hour ...
-
bioRxiv - Genetics 2021Quote: ... The pellet was then resuspended in the tagmentation reaction mix (25 μL 2X TD Buffer (Illumina, 15027866), 2.5 μL TD Enzyme (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... Pellets were resuspended in transposase reaction mix (25 μL 2x TD Buffer (Illumina Cat #FC-121-1030) 2.5 μL Tn5 Transposase (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Neuroscience 2023Quote: ... the nuclei were extracted and resuspended with the transposase reaction mix (25 μl 2x TD buffer (Illumina); 2,5 μl Transposase (Illumina) ...
-
bioRxiv - Genomics 2024Quote: ... The nuclei were resuspended in transposition reaction mix (2x TD Buffer (Illumina Cat #FC-121–1030, Nextera), 2.5 µl Tn5 Transposase (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... Nuclei were immediately resuspended in 25 μL of the transposition reaction mix (12.5μL 2x TD Buffer (Illumina), 1.25μL Tn5 Transposases ...
-
bioRxiv - Immunology 2021Quote: ... Cells were suspended in 50 uL of tagmentation master mix prepared from Illumina Tagment DNA TDE1 Enzyme and Buffer Kit components (#20034197) ...
-
bioRxiv - Cell Biology 2022Quote: ... and quantified by qPCR using the KAPA SYBR Fast qPCR Master Mix (Illumina). Paired- end single cell 3’ gene expression libraries were sequenced on a Novaseq 6000 System (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... 37 μL of the products was diluted to 50 μL of standard Phusion polymerase reaction mix in GC buffer with 0.1 μM primer M1 (annealing to the Illumina PE1.0 primer) and one of indexing primers M2,3 ...
-
bioRxiv - Genetics 2021Quote: ... 50,000 nuclei were incubated in the transposition reaction mix (20μl nuclease-free water; 25μl 2X Tagment DNA Buffer, Illumina Cat#FC-121-1030 ...
-
bioRxiv - Neuroscience 2021Quote: ... Beads were then resuspended in 25μL of tagmentation reaction mix containing 12.5μL of 2x Tagmentation DNA Buffer (Illumina #15027866) and 1μL of Tagment DNA Enzyme (Illumina #15027865) ...
-
bioRxiv - Genetics 2021Quote: ... The nuclei were resuspended in the transposition reaction mix (2x TD Buffer (Illumina Cat #FC-121-1030, Nextera), 2.5⍰μl Tn5 Transposase (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Immunology 2020Quote: ... the pellet was resuspended in 50 μL ATAC reaction mix (25uL 2X TD buffer, 2.5 μL Nextera Enzyme, 22.5 μL water, Illumina). The transposase reaction was carried out at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting pellet was resuspended in transposase reaction mix (25μl cold lysisl 2x TD buffer, 10μl cold lysisl transposase (Illumina), 15μl cold lysisl nuclease-free H2O ...
-
bioRxiv - Cancer Biology 2022Quote: ... The transposition reaction mix (25μl of 2X TD buffer, 2.5μl of Tn5 transposase (Illumina, San Diego, CA, USA), 15ul of PBS and 7.5μl of nuclease free water ...
-
bioRxiv - Developmental Biology 2022Quote: ... The cell pellet was then re-suspended in 50ml of transposition reaction mix (25ml 2x TD buffer (Illumina), 2.5ml transposase (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... DNA was tagmented by the addition of 10 µL of tagmentation mix (0.01 µL of a custom TDE1 enzyme in 9.99 µL of 2x Nexterda TD buffer, Illumina) and plates incubated at 55°C for 5 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were resuspended in 25uL of transposition mix (12.5ul 2x TD buffer, 1.25ul transposase (Illumina, catalog nr 20034197), 8.25ul PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclei were then resuspended in 50 μL transposition reaction mix containing 25 μL 2X Tagment DNA buffer (Illumina), 2.5 μL Tn5 transposase (Illumina) ...
-
bioRxiv - Immunology 2019Quote: ... The nuclei pellet was resuspended in 50 μL transposition mix (25 μl 2x TD buffer, 2.5 μl transposase (Illumina), 16.5 μl PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... The pellet was resuspended in transposase reaction mix (25 uL 2X TD buffer, 2.5 μL Transposase (Nextera DNA sample preparation kit, Illumina), and 22.5 μL H20 and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nuclei pellets were resuspended gently in transposition reaction mix (25 µL 2X TD Buffer [Illumina Cat #FC-121-1030], 2.5 µL transposase [Illumina Cat #FC-121-1030] and 22.5 µL nuclease-free water ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei pellets were then resuspended in 50 µl of transposition mix (2.5 µl Tn5 transposase, 25 µl 2x TD buffer (both Illumina), 0.5 µl 1% Digitonin (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... The pellet was resuspended in transposase reaction mix (25 µL 2X TD buffer, 2.5 µL Transposase (Nextera DNA sample preparation kit, Illumina), and 22.5 µL water and incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... Pelleted nuclei were resuspended in 50 μL transposition mix (25 μL 2x TD Buffer (Illumina (San Diego, CA, USA) 20034197) ...
-
bioRxiv - Genomics 2019Quote: ... the pellet was immediately resuspended in the transposase reaction mix (25 μL 2x TD buffer, 2.5 μL Transposase (Illumina) and 22.5 μL of nuclease free water) ...
-
bioRxiv - Genomics 2021Quote: ... and 5K samples were resuspended in 50 μl, 10 μl, and 5 μl of transposition mix (25 μl 2x TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Genomics 2022Quote: ... nuclei were spun at 4°C at 500g for 10 minutes and re-suspended in the transposase reaction mix (25ul 2X TD buffer, 2.5ul transposase (Illumina) and 22.5ul nuclease-free water) ...
-
bioRxiv - Genomics 2023Quote: ... nuclei pellet was resuspended with the transposition reaction mix (25 µl of 2x reaction buffer and 2.5 µl of Tn5 transposase from Nextera Sample Preparation Kit (Illumina), mixed with 22.5 µl nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... Supernatant was removed and nuclei were resuspended in 50 µL of transposition mix (25 µL 2x TD buffer, 2.5 µL transposase (Nextera Tn5 transposase, Illumina), 16.5 µL PBS ...
-
bioRxiv - Genetics 2023Quote: ... Nuclei were collected by centrifugation and resuspended in 50 µL transposase mix (25 µL 2x TD Buffer, 2.5 µL TDE1 transpose enzyme (Illumina Tagment DNA Enzyme and Buffer Small Kit ...