Labshake search
Citations for Millipore Sigma :
3501 - 3550 of 10000+ citations for 4 2 Hydroxy 1 Methoxyethyl 1 2 Benzenediol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... washed 3 times with PBS and incubated for 2 h with blocking and permeabilization buffer (1% BSA, 5% goat serum, 0.15% saponin (Sigma Aldrich)) ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were washed with cold DPBS for two times and then lysed in 2× Laemmli buffer (2% SDS, 20% glycerol, and 125 mM Tris-HCl, pH 6.8) supplemented with 1× protease inhibitor cocktail (Sigma, P8340). The cell lysate was scraped and sonicated ...
-
bioRxiv - Biophysics 2020Quote: ... For reduction and alkylation of the proteins, proteins were incubated with SDC buffer (1% Sodiumdeoxycholate, 40nmM 2-Cloroacetamide (Sigma-Aldrich), 10 mM tris(2-carboxyethyl ...
-
bioRxiv - Molecular Biology 2020Quote: ... then 1-2 mg (as indicated) of total protein was incubated with pre-washed M2 α-FLAG magnetic beads (Sigma) or MagStrep “type3” XT beads (IBA ...
-
bioRxiv - Microbiology 2020Quote: ... in serum-free media supplemented with 0,1 μg/ml L-1-p-Tosylamino-2-phenylethyl chloromethylketone (TPCK)-treated trypsin (Sigma–Aldrich). The supernatant was harvested at 72 h post infection when cytopathic effects were observed (with around 50% cell death) ...
-
bioRxiv - Microbiology 2021Quote: ... Frozen samples were thawed on ice for 2 min and 1 mL of HPLC grade methanol (Sigma, 34860-4L-R) added to the pellets ...
-
bioRxiv - Biochemistry 2020Quote: ... Bound scFv were detected using murine mAb 9E10 which recognizes the C-terminal c-myc tag (1:50 diluted in 2% MPBST) and a goat anti-mouse serum conjugated with horseradish peroxidase (HRP) (A0168, Sigma) (1:42000 dilution in 2% MPBST) ...
-
bioRxiv - Microbiology 2021Quote: ... Colicins B1-341 GFP/mCherry were expressed with a 6xHis tail at the C’ terminus and cloned into the multiple cloning site 2 of a pACYCDuet-1 (Novagen) plasmid where they were expressed under a T7 promotor ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were then washed 2 x 1 h in 100% MeOH followed by overnight incubation at RT in DiChloroMethane:MeOH (DCM, Sigma – 270997) 2:1 ...
-
bioRxiv - Microbiology 2021Quote: ... All samples were further concentrated to a final volume of 1-2 ml using 100 kDa Amicon-ultra filters (Merck Millipore).
-
bioRxiv - Neuroscience 2022Quote: ... Stemgent, 04-00046) and LDN-193189 (100 nM, Stemgent, 04-0074) along with doxycycline hyclate (2 µg.mL-1, Sigma, D9891) and Y27632 (5 mM ...
-
bioRxiv - Neuroscience 2022Quote: ... XAV939 (1 µM, Stemgent, 04-00046) and LDN-193189 (50 nM, Stemgent, 04-0074) with doxycycline hyclate (2 µg.mL-1, Sigma, D9891) and Zeocin (1 µg.mL-1 ...
-
bioRxiv - Microbiology 2022Quote: ... the Milliplex SARS-CoV-2 Antigen Panel 1 IgG was used according to the manufacturer’s instructions (Merck Millipore, Darmstadt, Germany).
-
bioRxiv - Immunology 2022Quote: ... at a concentration of 1 million/0.5ml in culture media [10% FBS in RPMI with 50uM 2-Mercaptoethanol (Sigma, M6250)] contains 20ng/ml mouse recombinant IL2 (R&D ...
-
bioRxiv - Systems Biology 2020Quote: ... at room temperature and rinsed 2 times quickly with 1%BSA-1XPBS by using a 0.22 μm Millex 33mm PES sterile filter (SLGSR33RS, Sigma-Aldrich) at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing cGAS shRNA sequences (shcGAS #1, TRCN0000428336; shcGAS #2, TRCN0000149811) and non-target shRNA control vector (shScramble, SHC016) were purchased from Sigma.
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The rehydrated slides were blocked with 2% horse-serum followed by incubation with primary antibodies (Mouse anti-S-glycoprotein antibody, 1:200 dilution, Millipore, Cat # MAB5676 ...
-
bioRxiv - Physiology 2020Quote: ... samples were then washed with PT and transferred into block solution [PT + 1% bovine serum albumin (BSA, Fisher) + 2% normal goat serum (NGS, Sigma) + 1% dimethyl sulfoxide (DMSO)] ...
-
bioRxiv - Plant Biology 2020Quote: ... resuspended in lysis buffer (50 mM Tris-HCl, pH 6.8, 2% SDS, and 10 mM EDTA) and 1× Protease inhibitor cocktail (Sigma-Aldrich) and incubated at 37°C for 30 min with shaking in a thermomixer ...
-
bioRxiv - Molecular Biology 2021Quote: ... the pellet was lysed with 2% SDS and total mtDNA was extracted by phenol/chloroform/isoamyl alcohol (25:24:1) (Sigma). After precipitation the labeled DNA were denatured at 95 °C for 15 min and separated by 0.8% agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2021Quote: ... Viruses were amplified on MDCK cells cultured in serum-free DMEM containing 0.5 μg/mL L-1-p-Tosylamino-2-phenylethyl chloromethyl ketone (TPCK)-treated trypsin (Sigma–Aldrich). Stocks were titrated by plaque assays on MDCK cells.
-
bioRxiv - Biochemistry 2020Quote: ... (2) LPS group: Mice received intranasal inhalation of 20 uL LPS (1 ug/uL, from Escherichia coli 0111:B4, Sigma) and i.v ...
-
bioRxiv - Cancer Biology 2021Quote: Primary HPMECs in EBM2 medium or ST1.6R cells in DMEM/1% FBS were cultured overnight and stimulated with 2 μg/ml of recombinant TNC (Merck Millipore) for 24 h ...
-
bioRxiv - Plant Biology 2020Quote: ... were isolated from 2-week-old dPPRrbcL-1 or Col-0 plants and incubated with monoclonal anti-HA antibodies (Sigma). IgGs were captured with Protein A DynaBeads (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... Target sequences (CTTCAACGTCTCTCAACAGAT #1 and CCGAGTTCTATGAGAACGACT#2) against human CD19 and a control scrambled sequence (CTCAATCAACAGATCTCGTCT) were inserted into the pLKO.1 vector (Sigma).
-
bioRxiv - Microbiology 2020Quote: ... or 40 µg/ml of trimethoprim-sulfamethoxazole (SXT) at a ratio of 1:19 (2 µg/ml of trimethoprim and 38 µg/ml of sulfamethoxazole; Sigma) as a positive control ...
-
bioRxiv - Cancer Biology 2020Quote: RH30 and RH41 cells were transfected with 100nM of human DDX5 specific siRNA (siDDX5 #1 and siDDX5 #2, Sigma-Aldrich) or scrambled control siRNA (siCTR ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The GC cell pellet was further suspended in 1-2 ml of serum free Dulbecco’s Modified Eagle Medium (DMEM) (Sigma, U.S.A) supplemented with 3 mM/ml of L-glutamine (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... washed in dilutions of SSC (2x and 0.2x) and TNT prior to blocking (1-2 hours in blocking solution of 5% heat-inactivated horse serum (Millipore Sigma), 0.5% Western Blocking Regent (Millipore Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed then sequentially incubated with anti-SARS-CoV-2 CR3022 antibody (Yuan et al., 2020) (1 μg/mL) and a HRP-conjugated goat anti-human IgG (Sigma) in PBS supplemented with 0.1% (w/v ...
-
bioRxiv - Neuroscience 2020Quote: ... from Tocris CGP-55845 ((2S)-3-[[(1S)-1-(3,4-Dichlorophenyl)ethyl]amino-2-hydro xypropyl](phenylmethyl)phosphinic acid hydrochloride) from Sigma-Aldrich
-
Myofiber injury induces capillary disruption and regeneration of disorganized microvascular networksbioRxiv - Physiology 2021Quote: ... The membrane permeant nuclear dye Hoechst 33342 (1 µM; #H1399, Fisher) was used to identify nuclei of all cells and propidium iodide (2 µM, #P4170, Sigma) to identify nuclei in dead and dying cells (14 ...
-
bioRxiv - Biochemistry 2021Quote: ... tRNA was incubated with 1/10 volume of 0.1 M ammonium acetate and nuclease P1 (2 U/µg tRNA, Sigma-Aldrich) at 45°Cfor 2 h ...
-
bioRxiv - Biochemistry 2021Quote: ... Input (2%) and bound (100%) fractions were resolved by SDS-PAGE and immunoblotted with HA (1:2,000, H3663, Sigma-Aldrich), GFP (1:4,000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Fertilized embryos (1-cell and 2-cell stage) were selected for culture in M16 medium (Sigma-Aldrich, MR-016-D) under mineral oil (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... immersion for delipidation was followed by indefinite immersion in BABB (benzyl alcohol + benzyl benzoate 1:2, Sigma, 24122 and W213802) solution for refractive index matching.
-
bioRxiv - Bioengineering 2021Quote: The collected BMOs were fixed with 2 % paraformaldehyde (PFA, ThermoFischer Scientific, 15434389) for 1 h and permeabilized with 0.3 % Triton-X-100 (Sigma, T8787) in PBS for 3 h at RT ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 0.33 mM MgSO4) in the presence of 150 mM of 1-phenyl-2-thiourea (PTU) (Millipore Sigma, Burlington, MA) to prevent pigment formation ...
-
bioRxiv - Cell Biology 2021Quote: ... were resuspended in DPBS at 2 - 5 million cells per ml and incubated with 1 µl (25 - 29 U) benzonase (Millipore) at 37 °C for a minimum of 1 hr ...
-
bioRxiv - Molecular Biology 2021Quote: ... subjected to freeze/thaw at -80°C, and sonicated in lysis buffer (1x PBS, 1% CHAPS, 10mM MgCl2, 2 µl benzonase (25 U/µl, Millipore), and protease inhibitor (Thermo Scientific)) ...
-
bioRxiv - Microbiology 2021Quote: ... harvesting at 3 dpi) using DMEM supplemented with 2% FBS and 1 μg/mL TPCK-trypsin (Sigma-Aldrich #1426-100MG). SARS-CoV and MERS-CoV viral stocks were generated by infecting VeroE6 cells (MOI 0.0001 ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by 2 h incubation with HRP-conjugated goat anti-rabbit antibody (1:10,000, Sigma-Aldrich, St. Louis, MO, USA). The signal was visualized by chemiluminescent detection using ECL.
-
bioRxiv - Neuroscience 2022Quote: ... followed by TBS-Tx (2 × 5 min) and incubated with primary antibody (Rat anti-muscarinic M2 monoclonal antibody, unconjugated, clone m2-2-b3, 1:750, Millipore Cat ...
-
bioRxiv - Pathology 2023Quote: ... cut open longitudinally and stained with a 2:1 mix of 0.5% Oil Red O in isopropanol (O1391, Sigma Aldrich) and deionized water for 10 min at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... mesothelial cells were pelleted at 800g for 2 mins and resuspended in 50:50 v/v of RPMI (supplemented with 10% FBS, 1× penicillin/streptomycin, 2 μg/ml heparin (Sigma) and 1 μg/ml hydrocortisone (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... Tetramethylammonium (TMA) oxalate solution was made by mixing a 2 to 1 molar ratio of aqueous TMA hydroxide (Sigma Aldrich) and ammonium oxalate monohydrate (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fbp1F/F and Fbp1ΔHep mice that were HFD fed for 12 wk or NCD-8 wo mice were fasted for 12-14 h and then given 1 g/kg glucose or sodium pyruvate (2 g/kg, Sigma) by i.p ...
-
bioRxiv - Molecular Biology 2023Quote: ... Exponentially growing RPE-1 (human retinal pigment epithelial) cells were pulse-labeled with CldU (5-Chloro-2’-deoxyuridine, Millipore Sigma) and IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Molecular Biology 2023Quote: A small fraction (2%) of each release sample was incubated overnight at 37°C with 1 mg/mL Proteinase K (Sigma), 4 mM CaCl2 ...
-
bioRxiv - Biophysics 2023Quote: ... The mixture was incubated on ice for approximately 1 h before the addition of Amberlite XAD-2 beads (Sigma-Aldrich). The reconstitution mixture was incubated at 4°C overnight on an orbital shaker.