Labshake search
Citations for Millipore Sigma :
3451 - 3500 of 10000+ citations for 4 2 Hydroxy 1 Methoxyethyl 1 2 Benzenediol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 mM glutamine (Sigma). This concentration of glucose and L ...
-
bioRxiv - Cell Biology 2024Quote: ... + 10% 2-metcaptoethanol (Sigma-Aldrich) was added ...
-
bioRxiv - Cancer Biology 2024Quote: ... 100 mM 2- mercaptoethanol (Millipore), 0.01 mM Non-Essential Amino-Acids ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mM EGTA (Sigma-Aldrich), 5 mM KCl (Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 mM EGTA (Sigma-Aldrich), 5 mM KCl (Fisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mM CaCl2 (Sigma, C3881), 5 mM D-trehalose (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 μM rosiglitazone (Sigma-Aldrich), and 2 μg/mL bovine insulin (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 μM 2-Mercaptoethanol (Sigma) and 10 ng/ml human bFGF (Peprotech) ...
-
bioRxiv - Neuroscience 2020Quote: ... N- (Piperidin-1-yl)-5- (4-iodophenyl)-1- (2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251, 3 mg/kg; Sigma Aldrich, St. Louis, MO), or vehicle (VEH ...
-
bioRxiv - Biochemistry 2020Quote: ... The full-length MtaLonA were prepared by supplementing the growing medium with 1 g l−1 of 15NH4Cl and 4 g l−1 of 2H7/12C6-glucose in 99.8%-2H2O (Sigma-Aldrich).
-
bioRxiv - Immunology 2024Quote: ... cells were either stimulated or not with 20 ng/mL of the γδ T cell stimulator (E)-4-Hydroxy-3-methyl-but-2enyl pyrophosphate (HMBPP; Sigma-Aldrich, Cat. No. 95098-1MG). CD107a-BV421 (Biolegend) ...
-
bioRxiv - Cell Biology 2020Quote: ... The fixed cells were then incubated with antibodies diluted in 1% BSA and 0.1% saponin at ambient temperature: 2 h with primary antibodies (anti-HDDC3, 1:25, cat# HPA040895, Sigma-Aldrich Co. ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 μM carbonyl cyanide p-trifluoromethoxyphenylhydrazone (FCCP) and 2 µM Antimicyn A / 1 µM Rotenone (all Sigma-Aldrich; Missouri, USA). The data were analyzed using Wave 2.6 Software ...
-
bioRxiv - Developmental Biology 2021Quote: Dissected brain-ring gland complexes were initially fixed in PBS with 2%PFA (cat#16005, Aldrich) and 1% glutaraldehyde (cat#G5882, Sigma) for 2 hours at room temperature followed by overnight incubation at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the MILLIPLEX® MAP 6-plex Bcl-2 Family Apoptosis Panel 1 Magnetic Bead Kit (Millipore: Cat. No. 48-682MAG) was utilized ...
-
bioRxiv - Synthetic Biology 2020Quote: Enriched M9 media was prepared using M9 salts (Difco M9 Minimal Salts) supplemented with 2 mmol L−1 magnesium sulfate (Sigma), 100 μmol L−1 calcium chloride (Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: For stable knock down of PYCR1, shPYCR1 (shPCYR1 #1: CCGGTGAGAAGAA GCTGTCAGCGTTCTCGAGAACGCTGACAGCTTCTTCTCATTTTTG, shPYCR1 #2: CCGGCACAGTTTCTGC TCTCAGGAACTCGAGTTCCTGAGAGCAGAAACTGTGTTTTTG) and shCTL (Sigma, Mission shRNA) lentivirus was generated in HEK293 cells ...
-
bioRxiv - Immunology 2021Quote: ... 106 cells per sample were cultured in RPMI containing 2% FBS and stimulated with PMA (50 ng ml−1, Sigma), ionomycin (2 μg ml−1 ...
-
bioRxiv - Cell Biology 2020Quote: Imaging was performed on live animals mounted on a 2% agarose pad on glass slides with 1 mM levamisole (Sigma). For quantification of purified mitochondria and mitochondrial membrane potential ...
-
bioRxiv - Bioengineering 2020Quote: ... were added to desalted (GT)15 oligonucleotide (2 mg, Integrated DNA Technologies) in a microcentrifuge tube with NaCl solution (1 mL, 0.1 M, Sigma-Aldrich). The mixture was then ultrasonicated using a 1/8″ tapered microtip (Sonics Vibracell ...
-
bioRxiv - Bioengineering 2020Quote: ... and cells were fed with a continuous flow at 1 Psi of HS media containing 2% glucose and 0.001% Fluorescence Brighter 28 (Sigma-Aldrich). After 24 hours ...
-
bioRxiv - Immunology 2020Quote: ... from 1:50 to 1:51200 in PBS containing 2% skimmed milk were added followed by ALP-conjugated anti-human IgG (A9544; Sigma) at 1:10,000 dilution ...
-
bioRxiv - Cancer Biology 2021Quote: ... and HCT116 cells with acquired BOLD-100/KP1339 resistance were seeded as 2 × 105 cells/well in 12-well plate formate in 1 mL McCoy’s medium (Sigma Aldrich) supplemented with 2 mm glutamine and 10% FCS ...
-
bioRxiv - Cell Biology 2021Quote: Cells were grown to early log phase in synthetic complete (SC) media + 2% glycerol + 1% ethanol and gently sonicated before being loaded into a CellASIC Y04C microfluidics plate (Milipore SIGMA) under continuous media flow at 2 psi ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked in normal donkey serum in PBST (2%) and transferred to rabbit anti-Fos primary antibody (1:10000; EMD Millipore) in PBST and normal donkey serum for 16 hr at RT ...
-
bioRxiv - Microbiology 2020Quote: Whole cell protein fractions were prepared by centrifuging 1 ml of overnight bacterial culture and resuspending the cell pellet in 2 x Laemmli sample buffer (Sigma) and boiled for 5 min at 100°C ...
-
bioRxiv - Plant Biology 2020Quote: ... Purity of the purified protein was controlled on SDS-PAGE and it was brought to a final concentration of 2 mg mL-1 using an Amicon-Ultra device (Millipore). Polyclonal antibodies against FAP were raised in rabbits (ProteoGenix ...
-
bioRxiv - Microbiology 2020Quote: ... Residual methylation reagents were neutralised by addition of 1M Tris-HCl pH 7.5 to a final concentration of 50 mM Tris-HCl and the protein complex was concentrated to 2 mg mL−1 using 30 kDa cut-off concentrators (Millipore) before injection into a S75 16/600 column (GE Healthcare ...
-
bioRxiv - Systems Biology 2021Quote: ... coli strain and cultured the cells in M9 minimal medium (Difco) supplemented with 1/2 MEM amino acids solution (SIGMA) and 0.2% (w/v ...
-
bioRxiv - Plant Biology 2021Quote: ... green tissues of 2- to 3-week old plants were sprayed until drop-off with 1 mM SA (Sigma Aldrich), 100 μM MeJA (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2020Quote: ... then diluted to 1×107 cells/ml in liquid YPAD and incubated at 30°C for 2 hours before crosslinking with 1% formaldehyde (Sigma) for 15 minutes followed by quenching with 125 mM glycine for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... (25 mg l−1) and sodium salicylate (from 0.1 mM to 2 mM) All reagents were purchased from Sigma Aldrich, except for X-Gal ...
-
bioRxiv - Microbiology 2021Quote: ... in serum-free media supplemented with 0,1 μg/ml L-1-p-Tosylamino-2-phenylethyl chloromethylketone (TPCK)-treated trypsin (Sigma-Aldrich). The supernatant was harvested at 72 h post infection when cytopathic effects were observed (with around 50% cell death) ...
-
bioRxiv - Plant Biology 2021Quote: ... Wild-type and mutated Pik-1 and Pik-2 proteins were detected probing the membrane with anti-FLAG M2 antibody (Sigma) and anti-HA high affinity antibody 3F10 (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... with PBS +0.05% Tween20 and bound FLAG-ACE-2 was detected with HRP-conjugated anti-FLAG antibody (1:20,000, Sigma cat# A8592) and peroxidase substrate (KPL ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were irradiated using 8 J/m2 UV and labelled for 7 hours with 20 µM 5-Ethynyl-2’-deoxyuridin (EdU) and 1 µM Floxouridine (Sigma). Subsequently ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CH-5high/CH-6high subpopulation breast cancer cells (cell numbers: 0.5million) were mixed with 100μl Matrigel/cell culture media mixture (Matrigel: cell culture media = 1:2) (Sigma or Corning). Indicated cancer cells/Matrigel/ cell culture media mixtures were injected into NOD/SCID female for breast cancer xenograft (the Jackson Laboratory ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary antibodies were diluted in high-salt TBS + 2% BSA + 0.1% Triton X-100 at 1:4000 (mouse anti-a-tubulin, Sigma #T6199) and 2 µg/mL (rabbit anti-CENP-A ...
-
bioRxiv - Cell Biology 2022Quote: ... and 10 µg ml−1 of L-ascorbic acid or 2-Phospho-L-ascorbic acid trisodium salt (Vitamin C) (Sigma). NSCs were cultured in NSC complete medium consisting of DMEM/F-12 Media ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dynabeads following the first pulldown were resuspended in Re-ChIP elution buffer (20 mM Tris-Cl pH 7.5, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 100 µg of 3X FLAG peptide [Sigma, #F4799]), and incubated in 4 °C for 1 hour with rotation to selectively elute FLAG-fusion protein ...
-
bioRxiv - Microbiology 2022Quote: We cultured the cells with either Luria-Bertani (LB) broth (Difco) or M9 minimal medium (Difco) supplemented with 1/2 MEM amino acids solution (SIGMA) and 0.2% (w/v ...
-
bioRxiv - Immunology 2022Quote: ... the different mouse groups were killed 1 hour after retro-orbital injection of 100 μl of 2% Evans blue (EB) dye (Sigma) and were perfused intracardially with 15 ml of PBS ...
-
bioRxiv - Biophysics 2022Quote: ... 1-oleoyl-2-(12-biotinyl(aminododecanoyl))-sn-glycero-3-phosphoethanolamine (biotin-PE) and Tween-20 were purchased from Sigma Aldrich. Tween-20 was suspended in 50 mM Tris buffer (pH 8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CH-5high/CH-6high subpopulation breast cancer cells (cell numbers: 0.5million) were mixed with 100μl Matrigel/cell culture media mixture (Matrigel: cell culture media = 1:2) (Sigma or Corning). Indicated cancer cells/Matrigel/ cell culture media mixtures were injected into NOD/SCID female for breast cancer xenograft (the Jackson Laboratory ...
-
bioRxiv - Cell Biology 2022Quote: A solution of methimazole (1-methyl-3H-imidazole-2-thione) (CAS 60-56-0; MW, 114.17 g/mol; purity, ≥99%; Sigma-Aldrich) was used to induce hypothyroidism ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 1% protease inhibitor and phosphatase inhibitor cocktail 2 and 3 (all from Sigma Aldrich, St. Louis, MO, USA). Samples were centrifuged at 14,000 rpm for 20 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were lysed in 2% CHAPS lysis buffer (20 mmol/l Tris-HCl, pH 7.5; 150 mmol/l NaCl; 1 mmol/l EDTA; 2% CHAPS; Sigma-Aldrich) with protease and phosphatase inhibitors (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... Beads were then washed four times with lysis buffer and eluted in 2x Laemmli buffer containing 1% 2-mercaptoethanol (Sigma) by heating at 95°C for 3min.
-
bioRxiv - Pathology 2021Quote: Left lungs were put in 2 ml microtubes with 1 ml prewarmed PBS containing 200 units of collagenase (Sigma, C9891) and 0.9 mM of calcium and magnesium ...
-
A novel Hsp90 phospho-switch modulates virulence in the major human fungal pathogen Candida albicansbioRxiv - Microbiology 2020Quote: ... washed twice in 1x PBS and resuspended in 2 ml co-IP lysis buffer (50 mM Tris-HCl pH 7.5, 1% Nonidet P 40 Substitute (Sigma #74385), 0.25% deoxycholate Na ...