Labshake search
Citations for Millipore Sigma :
2001 - 2050 of 10000+ citations for Mouse DTW Domain Containing Protein 2 DTWD2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Plates were then blocked for 6 h with PBST (PBS with 0.01% Tween-20) containing 2% BSA (Sigma-Aldrich; cat. no. 10735094001) at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Frozen brain tissue was homogenised in a dounce-homogeniser containing 2 ml ice-cold lysis solution (Nuclei EZ Lysis Buffer [Sigma-Aldrich, NUC101] or Nuclei PURE Lysis buffer [Sigma-Aldrich, NUC201] with 1 mM dithiothreitol [DTT ...
-
bioRxiv - Neuroscience 2024Quote: ... cells from one T-25 flask were dissociated with 2 mL of dissociation reagent containing papain (50U; Sigma-Aldrich; Cat. No. P4762) and Accutase (Thermo-Fischer Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... and mouse anti-ferret totIg (mAb 8H9 + mAb 4B10) diluted each to 1 µg/mL in blocking buffer (PBS containing 2% BSA [Sigma-Aldrich], 1% bovine gelatin [Sigma-Aldrich] ...
-
bioRxiv - Molecular Biology 2024Quote: The standard assay for ALP activity was carried out in 500 μL of the reaction mixture containing 2 mM pNPP (Sigma-Aldrich, USA) in 0.1 M Tris–HCl buffer ...
-
bioRxiv - Bioengineering 2024Quote: ... cells were seeded at 1.5 x103/cm2 on 13 mm coverslips in 24 well-plates and cultured in DMEM containing 2% with human AB serum (HS; Sigma Aldrich, H4522) in a 5% humidified CO2 atmosphere at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Worms were synchronized by bleaching and Day 1 adults were plated on NGM plates containing 100 µM 5-Fluoro-2′-deoxyuridine (FuDR) (Sigma Cat. F0503) with or without 4 mM methyl viologen dichloride hydrate (paraquat ...
-
bioRxiv - Genetics 2024Quote: ... the cells were starved for 24 hours with 2% FBS-containing culture media and were treated with SAG (Sigma #566661: 500 nM) in 2% FBS-containing culture media for another 24 hours before harvest ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Immunology 2021Quote: ... ELISA plates were coated with the capturing reagent in PBS [OVA (Sigma, A5503) for antigen ELISAs ...
-
bioRxiv - Microbiology 2021Quote: ... 5′5′-Tetramethylbenzidine (TMB) Liquid Substrate System for ELISA (Sigma-Aldrich, Taufkirchen, Germany) was added until a colour change was observed ...
-
bioRxiv - Neuroscience 2021Quote: Alongside the ELISA a Bicinchoninic acid assay (BCA) assay (#71285-3, Novagen, Millipore) was performed according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: Alongside the ELISA a Bicinchoninic acid assay (BCA) assay (#71285-3, Novagen, Millipore) was performed according to manufacturer’s protocol ...
-
bioRxiv - Pathology 2019Quote: ... BR) and insulin Elisa assay (cat#EZRMI-13K, Merck Millipore, Billerica, MA, EUA) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Overnight fasting serum levels were quantified by ELISA for insulin (#EZRMI-13K; Millipore) and leptin (#90030 ...
-
bioRxiv - Genetics 2020Quote: ... Cell lines were tested for mycoplasma contamination using the Mycoplasma PCR ELISA (Sigma).
-
bioRxiv - Immunology 2022Quote: ... SAA and CTX-I were measured using the human SAA ELISA (Sigma-Aldrich) and Serum Crosslaps (CTX-I ...
-
bioRxiv - Microbiology 2023Quote: Costar 96-well ELISA plates were coated with 10 μg of fibronectin (Sigma) for the fibronectin-binding assay and 10 μg of fibrinogen (Sigma ...
-
bioRxiv - Physiology 2023Quote: ... and plasma insulin (n=5) was analyzed by ELISA (EZRMI-13K, Sigma Aldrich), according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Plasma insulin was measured by enzyme-linked immunosorbent assay (ELISA) (Millipore, Burlington MA).
-
bioRxiv - Immunology 2024Quote: ... 96-well ELISA plates were first coated overnight with poly-L-lysine (Sigma), then overnight with DNA from calf thymus (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... corresponding to residues within the LCC domain) were used at 50 µg mL-1 (clone CL3112, AMAB91123, Sigma-Aldrich, St. Louis, Missouri, US) and mouse IgG for IHC (31903 ...
-
bioRxiv - Cancer Biology 2023Quote: ... (2) 2% Alconox (Sigma, 242985 ...
-
bioRxiv - Cancer Biology 2024Quote: ... (2) 2% Alconox (Sigma 242985 ...
-
bioRxiv - Plant Biology 2021Quote: ... We prepared InsP7 by using 100ng of Mouse IP6K1 (mIP6K1) recombinant protein along with 100 µM of InsP6 (Sigma, USA) in a buffer containing 20 mM HEPES (pH 7.5) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 50 μl of Protein G magnetic beads were used and 10 μg of mouse monoclonal anti-FLAG primary antibody M2 (Sigma) were added before overnight incubation at 4°C with the lysate ...
-
bioRxiv - Immunology 2021Quote: ... In the three subsequent boosters the amount of protein used was 25 μg per mouse mixed with incomplete Freund’s adjuvant (Sigma, India). Boosts were given on days 15 and 28 post-priming ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were stained overnight at 4°C with primary antibody (Mouse anti-γH2AX antibody; Millipore Sigma #05-636, 1:300) diluted in blocking solution ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 mg of proteins was used to performed incubation overnight at 4°C with 5 μg of anti-Flag mouse antibody (Sigma) in 250 μL of complemented non-denaturing lysis buffer ...
-
bioRxiv - Microbiology 2021Quote: ... nsp8 and nsp12 proteins were subsequently detected using the mouse monoclonal anti-DYKDDDDK M2 antibody (Catalogue number F3165, Sigma-Aldrich) diluted 1:1000 in TBST/5% milk ...
-
bioRxiv - Microbiology 2020Quote: ... Serial dilutions of mouse sera were tested for binding to the biotinylated proteins and the bound antibodies detected using HRP-conjugated anti-mouse IgG A4416 (Sigma) and TMB substrate (Life Technologies).
-
bioRxiv - Developmental Biology 2021Quote: ... 30 μl of Protein G coated Bio-Adembeads (Ademtech) were incubated with either 1 μg of mouse monoclonal anti-FLAG antibody (F3165, Sigma), or goat anti-HA antibody as mock (sc-805 ...
-
bioRxiv - Immunology 2022Quote: ... and spike protein-bound antibodies were detected using an Anti-Mouse IgG (Fc Specific)-Alkaline Phosphatase antibody (Sigma-Aldrich, #A2429) at a 1:4000 dilution in blocking buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were then pre-cleared using 25 μL of Protein A agarose beads (Pierce) and then incubated with 25 μL of mouse anti-V5 agarose beads (Sigma) and washed with RIPA buffer ...
-
bioRxiv - Plant Biology 2022Quote: ... A 1–month–old ICR mouse (SLAC laboratory animal) was injected with 50 μg GST–CAR9 protein emulsified with Complete Freund’s adjuvant (F5881, Sigma–Aldrich). Two weeks later ...
-
bioRxiv - Developmental Biology 2020Quote: ... The trophectoderm was removed by immunosurgery and “epiblasts” were grown in gelatinised dishes in the presence of NDiff + 2i and ESGRO (recombinant mouse LIF Protein, Millipore) to establish ESC lines.
-
bioRxiv - Cell Biology 2020Quote: ... were washed with 100 μl worm protein lysis buffer and incubated with monoclonal M2 mouse anti-Flag antibody (Sigma, F3165) or monoclonal rabbit anti-c-Myc antibody (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... were superovulated by serial Pregnant Mare Serum Gonadotropin (5 IU per mouse, Prospec Protein Specialists) and human chorionic gonadotropin (5 IU, Millipore) injections 46 h apart ...
-
bioRxiv - Immunology 2021Quote: ... the purified MECU protein was separated on 12% SDS-PAGE and further probed with mouse polyclonal anti-His (Sigma, USA) and rabbit polyclonal anti-H ...
-
bioRxiv - Neuroscience 2020Quote: ... SI and protein extracts from human and mouse samples were resolved in SDS-PAGE transferred to Immobilon-P PVDF membranes (Millipore). Membranes were activated with methanol and blocked with 4 % bovine serum albumin (BSA ...
-
bioRxiv - Biophysics 2022Quote: ... The pre-cleared lysates were then incubated with 100 µL of antibody/protein A complexed beads (anti-FLAG [mouse, Sigma, F1804] or anti-HA [mouse ...
-
bioRxiv - Molecular Biology 2022Quote: ... Golgi apparatus was detected with mouse anti-Golgi 58K protein /formiminotransferase cyclodeaminase (FTCD) antibody (G2404, SIGMA-Aldrich, Prague, Czech Republic). The following secondary antibodies were used for detection ...
-
bioRxiv - Immunology 2022Quote: ... growth factors) in mouse whole lung protein were quantified using EMD Millipore’s MILLIPLEX Magnetic Bead Panel (Millipore Sigma #MCYTOMAG-70K), including ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein expression of the mouse or human 5-HT3A was induced by the addition of 4 μg/mL tetracycline (Sigma). Valproic acid (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... Further confirmation of purification of the recombinant protein was obtained by immunoblots probed with mouse anti-polyhistidine IgG (Sigma-Aldrich) and goat anti-mouse alkaline phosphatase-conjugated antibodies (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were incubated overnight at 4 °C with antibodies that recognise specific proteins expressed by each cell type such as mouse anti-NeuN (1:250; Millipore) to label neurons ...
-
bioRxiv - Cell Biology 2024Quote: ... TRPM2-FLAG protein was probed with mouse anti-FLAG®M2 antibodies (F1804, Sigma; primary, 1:5000 in blocking buffer) in conjunction with HRP-conjugated goat anti-mouse IgG (A16078 ...
-
bioRxiv - Neuroscience 2021Quote: ... Kyoto University) and mouse anti-glutamic acid decarboxylase of 67 kDa (GAD67; 2 μg/mL; MAB5406, Millipore, RRID: AB_2278725) in Triton-PBS containing 1% v/v donkey serum (Jackson Immunoresearch ...
-
bioRxiv - Genomics 2021Quote: ... Cells were pelleted again and resuspended in 50 µL of permeabilization buffer with 2% mouse serum (Millipore Sigma, M5905) to block for 10 minutes at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... the mouse anti-alpha-tubulin B-5-1-2 was used at a dilution of 1:500 (Sigma, T5168). Polyclonal rabbit anti-TgCentrin1 (Fig ...