Labshake search
Citations for Millipore Sigma :
1851 - 1900 of 10000+ citations for SARS CoV 2 Spike Glycoprotein S2 aa 1000 1200 His Tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and E-cad shRNA (TRCN0000237841, target sequence; AGATTGCACCGGTCGACAAAG, Millipore Sigma). Lentiviral supernatant was prepared by co-transfecting HEK-293T cells with lentivirus packaging plasmids ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... D-Asp3-E-Dhb7-RR was purchased from Sigma Aldrich. Anabaenopeptin A and B ...
-
bioRxiv - Bioengineering 2024Quote: Channel blockers E-4031 and nifedipine were purchased from Sigma, aliquoted in DMSO at a concentration of 10 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... Rabbit polyclonal anti-α E-catenin (C2081) was from Sigma. Rabbit polyclonal anti-phospho-Myosin Light Chain 2 (Thr18/Ser19 ...
-
bioRxiv - Neuroscience 2023Quote: ... hNPCs were treated with 100 nM compound E (EMD Millipore) in Neural Medium for 48 hours and then maintained in Neural Medium supplemented with 20 ng/ml each of hBDNF and hGDNF for 3 weeks ...
-
bioRxiv - Cell Biology 2023Quote: ... Following resuspension in 50 ml/tube of E-MEM (Sigma), large cell aggregates were eliminated by filtering the cell suspension with a 60-μm stainless cell strainer (Ikemoto Scientific Technology) ...
-
bioRxiv - Biochemistry 2023Quote: ... William’s E Medium and hydrocortisone were purchased from Sigma Aldrich. Human insulin was purchased from pharmacy (Humulin N ...
-
bioRxiv - Cell Biology 2023Quote: ... and rat anti-human E-cadherin (EMD Millipore, DECMA-1) at a concentration of 1/200 in a humidified incubator overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... apolipoprotein E (ApoE, raised in goat, 1:500, 178479, Millipore).
-
bioRxiv - Microbiology 2024Quote: ... and sections stained with H&E (Sigma-Aldrich, Darmstadt, Germany). Slides were scanned using Aperio AT Turbo (Aperio ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 ng/ ml epidermal growth factor (Sigma-Aldrich, e-4127), 0.5 µg/ ml hydrocortisone (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: PFA-fixed mouse blood was thoroughly vortexed with only 25% w/v screened chemicals (Sigma, Table S2) or only detergents (10% w/v CHAPS ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Primers used in this work are listed in Appendix Table S2 and were provided by Sigma-Aldrich Co (St ...
-
bioRxiv - Molecular Biology 2022Quote: The released soluble chromatin S2 was concentrated on Amicon ®Ultra-15 mL centrifugal filters (Millipore UFC9050) to 0.35-0.5 mL with the final concentration ranging from 4.0-8.0 mg/mL ...
-
bioRxiv - Bioengineering 2022Quote: Suit2-007 cells (S2, passages 5-8) were cultured in Dulbecco’s Modified Eagle’s Media (Sigma-Aldrich, D8437) supplemented with 10% v/v FBS (Cat No.F7524 ...
-
bioRxiv - Neuroscience 2023Quote: S2 cells were obtained from the Drosophila Genomics Research Center and maintained in Schneider’s Medium (Sigma S0146), supplemented with Insect Media Supplement (Sigma I7267) ...
-
bioRxiv - Developmental Biology 2023Quote: ... S2 cells were cultured at 25 °C in in Schneider’s Insect Medium (Sigma-Aldrich Co. LLC #S0146) containing 10% heat inactivated fetal bovine serum (FBS) ...
-
bioRxiv - Neuroscience 2023Quote: ... carvone (Od1) / Citral (Od2) for S1 session and limonene (Od1) / anethol (Od2) for S2 session (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2024Quote: S2 and Kc167 (Kc) cells were cultured at 27°C degrees in Schneider’s Insect Medium (Sigma-Aldrich) containing 10% FBS and CCM3 Serum-Free Medium (HyClone ...
-
bioRxiv - Cell Biology 2024Quote: The primary antibodies used for immunofluorescence in S2 cells were mouse anti-α-tubulin B512 (Sigma-Aldrich) used at 1:5000 ...
-
bioRxiv - Biochemistry 2019Quote: ... The cell lysate was combined with His-Select Co2+ resin (Sigma) for 1 hour at 4 °C ...
-
bioRxiv - Biophysics 2021Quote: ... anti-6×His and anti-FLAG M2 (Sigma-Aldrich, Merck, USA). The anti-mouse IgG ...
-
bioRxiv - Biochemistry 2021Quote: ... Clarified lysate was applied to Ni-NTA His-Bind Resin (Novagen). Resin was washed with binding buffer and then eluted in batches with buffer containing increasing amounts of imidazole (up to 800 mM) ...
-
bioRxiv - Biochemistry 2021Quote: ... Clarified lysate was applied to Ni-NTA His-Bind Resin (Novagen). Resin was washed with binding buffer and then eluted in batches with buffer containing increasing amounts of imidazole (up to 300 mM) ...
-
bioRxiv - Microbiology 2021Quote: ... and a combination of α-6×His antibody (Sigma Aldrich, H1029) and HisProbe-HRP (Thermo ...
-
bioRxiv - Biophysics 2021Quote: ... the proteins were purified using His-Select Nickel agarose resin (Sigma) and anion exchange chromatography (Source Q ...
-
bioRxiv - Plant Biology 2022Quote: PIF3 recombinant proteins were prepared using PIF3-his DNA (pET28C, Novagen) provided by Ferenc Nagy and induced and purified using commercial kit (Amersham) ...
-
bioRxiv - Cell Biology 2021Quote: His-ACBD5 was expressed in BL21 Rosetta (DE3) cells (EMD Millipore) induced with 1 mM IPTG overnight at 18°C ...
-
bioRxiv - Plant Biology 2019Quote: ... His-tagged recombinant protein was eluded with 250 mM imidazole (Sigma).
-
bioRxiv - Microbiology 2021Quote: ... Ni2+-NTA His-bind slurry was obtained from Novagen (Darmstadt, Germany). Rhodamine B isothiocyanate-Dextran (RITC-Dextran ...
-
bioRxiv - Plant Biology 2021Quote: ... Fusion proteins were purified using Ni2+-containing His-Bind columns (Novagen). Purified proteins were desalted and concentrated by ultracentrifugation (Amicon ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by immunoblotting with HRP-conjugated anti-His antibody (Sigma-Aldrich) by using SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2019Quote: ... was incubated with recombinant His-tagged human HDAC6 protein (EMD Millipore) in 250 μl RB100 buffer (25 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2020Quote: ... or 15 U/mg His-tagged SUMO protease (Millipore Sigma SAE0067) by overnight incubation at 4 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... –Ade (20 ug/mL L-His HCl monohydrate (A-9126, Sigma) added to –Trp ...
-
bioRxiv - Immunology 2021Quote: ... either supplemented with 10% HI dialysed and filtered FCS (Sigma-Aldrich) 0.1M HEPES ...
-
bioRxiv - Microbiology 2021Quote: ... probed using 1:500 monoclonal anti-His HRP-conjugated antibodies (Sigma) and imaged using a ChemiDoc MP (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... the ORF of eggpl was inserted into vector piztv5-His (Novagen) in our laborary to overexpress eggpl ...
-
bioRxiv - Plant Biology 2022Quote: ... loaded onto His-Bind® Resin columns (EMD Millipore; Merck KGaA), and the recombinant ZmEREB57 protein was eluted with elution buffer (0.5 M NaCl ...
-
bioRxiv - Neuroscience 2023Quote: ... The supernatant was loaded onto Ni-resin (HIS-Select, Sigma-Aldrich) and washed with buffer 1 (50 mM Hepes-KOH pH7.6 ...
-
bioRxiv - Biochemistry 2023Quote: ... or anti-His primary antibodies (dilution 1:3000, #H1029 Sigma Aldrich).
-
bioRxiv - Biochemistry 2023Quote: ... and supernatant was bound to Ni-NTA His-Bind Resin (Novagen) for 1hr at 4 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Anti-His-specific monoclonal antibodies were from EMD Millipore (prod # 70796). Anti-T7 tag-specific monoclonal antibodies were from Novagen.
-
bioRxiv - Genomics 2020Quote: The amyloid beta 1-42 peptides and the respective control peptides (having the reverse aa sequence compared to 1-42 peptides) were synthesized by Sigma Aldrich’s custom synthesis service using the following sequences ...
-
bioRxiv - Cell Biology 2019Quote: ... fragments of NUP153 (AAS 228-611) were fused C-terminally to GST in pGEX4T-3 and expressed in BL21 DE3 cells (Sigma CMC0014). Cell pellets were lysed (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Microbiology 2021Quote: ... The viral particles were suspended in 10 ml phosphate-buffered saline (PBS) and filtered using a 0.45-μm filter (Millex-AA, Merck Millipore, Darmstadt, Germany). The filtered viral particles were centrifuged (8,500×g ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysate was then centrifuged at 12,520 x g for 30 min and the supernatant solution was filtered through a 0.8 µm syringe filter (Millex-AA, Millipore, Burlington, MA) before adding it to 2 ml of Strep-Tactin superflow resin (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: ... Control cultures were swapped from SM supplemented with 13C-glucose to SM solely supplemented with 12C-amino acids (12C-AA; Sigma #Y1896) at standard culturing concentrations.
-
bioRxiv - Neuroscience 2021Quote: ... 0.1 μM LDN193189 (Stemgent, #04-0074), 3μM CHIR-99021 (Selleck, #51263) and 10 μM Ascorbic Acid (AA) (Sigma, #A 0278-100G).The “N2B27” medium is composed of equal volumes of ADMEM/F12 (Thermofisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were amino acid (AA) stimulated in two ways: 1) An amino acid solution (RPMI 1640 Amino Acid Solution [50x] (Sigma # R7131) supplemented with L-glutamine (Sigma # G8540 ...