Labshake search
Citations for Millipore Sigma :
1501 - 1544 of 1544 citations for Non Ab Component of Alzheimer's Disease Amyloid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Levels of cytokines/chemokines in macaque plasma were measured using the Milliplex MAP non-human primate cytokine panel and Luminex 200 (Millipore Corp., Billerica, MA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... SH-SY5Y and Hep G2 cells were maintained in DMEM with 1 % of MEM Non-essential Amino Acid Solution 100x (NEAA) (Sigma Cat. No: M7145), SuBK12-08 and Tb 1 Lu in Eagle’s Minimum Essential Medium (EMEM ...
-
bioRxiv - Immunology 2020Quote: ... For intracellular cytokine staining B cells were activated or non-activated with anti-IgM/CpG in the presence of 5 mg/mL brefeldin A (BFA, Sigma, catalogue number: B6542) to prevent cytokine release ...
-
bioRxiv - Pathology 2022Quote: ... 1% penicillin/streptomycin and 1% MEM Non-essential Amino Acid Solution (all three reagents were purchased from Sigma-Aldrich, St. Louis, MO, USA). Cells were cultured at a density lower than 1 × 106/ml to ensure logarithmic growth.
-
bioRxiv - Biochemistry 2023Quote: ... To make the calibration curves a non-labelled amino acid mixture was made from an analytical amino acid standard without glutamine and asparagine (Sigma-Aldrich, A9906-1ML) and added glutamine (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ml of differentiation medium (10% FBS (Millipore, Cat.No. ES-009-B, 1X L-Glutamine (Thermo Fisher, Cat.No.25030081, 1X Non-Essential AA, Millipore, Cat.No. TMS-001-C), 0.15 mM 2-Mercaptoethanol (Millipore ...
-
bioRxiv - Cancer Biology 2023Quote: The custom constructs for sh-TBX2 and its non-targeting scrambled RNA duplex siRNA control (NTSCR) was procured from sigma Aldrich (RNAi single clones, Millipore sigma, Burlington, MA). These lentiviral constructs along with packaging plasmid (pCMV delta R8.2 dvpr ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 plasmids containing shRNAs targeting KCNN4 and control non-target sequences (Supplementary Table 1) were obtained from Sigma-Aldrich (St Louis, USA) and transfected into HEK293T cells with a packaging mix that contains a pCMV-dR8.91 (Delta 8.9 ...
-
bioRxiv - Cell Biology 2023Quote: ... Manipulations of peptide/protein on planar glass-supported lipid bilayer was achieved by incubation in high salt concentration (20mM HEPES 150mM NaCl, for 10 min at room temperature) or non-labelable streptavidin (10μg/mL, Sigma-Aldrich, Cat No. 189730). For His6x-TLR2-ID-FLAG ...
-
bioRxiv - Neuroscience 2022Quote: ... S-IRA was evoked in non-primed DBA/1 mice by IP administration of a single dose of PTZ (Cat #P6500; Sigma-Aldrich, St. Louis, MO) at a dose of 75 mg/kg ...
-
bioRxiv - Neuroscience 2020Quote: ... S-IRA was evoked in all non-primed DBA/1 mice by the IP administration of a single dose of PTZ (Cat # P6500; Sigma-Aldrich, St. Louis, MO) at a dose of 75 mg/kg ...
-
bioRxiv - Neuroscience 2022Quote: ... S-IRA was also established in all non-primed DBA/1 mice by IP administration of a single dose of PTZ (Cat #P6500; Sigma-Aldrich, St. Louis, MO) at a dose of 75 mg/kg.
-
bioRxiv - Microbiology 2022Quote: Levels of cytokines/chemokines in macaque plasma were measured using the Milliplex MAP Non-human Primate Cytokine Panel in combination with a Luminex 200 (Millipore Corp., Billerica, MA, USA) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... the cell suspension was poured twice more and inserted into a tunnel chamber which was assembled by taping coverslips cleaned with saturated ethanolic KOH and precoated with 100% non-heat-inactivated horse serum for 60 min and 10 mg/ml bovine serum albumin (Sigma-Aldrich, St. Louis, MO) in PBS for 60 min at RT ...
-
bioRxiv - Neuroscience 2019Quote: ... They were fed with the same neuron chow and proliferation of non-neuronal cells was arrested by the addition of 1 µM cytosine arabinoside (Sigma-Aldrich, St. Louis, MO) at DIV 5 ...
-
bioRxiv - Genomics 2021Quote: ... Serum samples obtained from vaccinated and non-vaccinated individuals were stored at −20°C until tested treated with receptor destroying enzyme (RDE) (Sigma C8772, diluted 1:4), for 16 h prior to heat inactivation (30 min ...
-
bioRxiv - Physiology 2021Quote: ... Parametric and non-parametric tests were used based on results from normality (Shapiro-Wilk) and equal variance (Brown-Forsythe) tests (Sigma Plot v.13, Systat). All data are shown as mean ± SD or scatter plots with bars indicating group means ...
-
Force and stepwise movements of gliding motility in human pathogenic bacterium Mycoplasma pneumoniaebioRxiv - Microbiology 2021Quote: ... which was assembled by taping coverslips cleaned with saturated ethanolic KOH and precoated with 100% non-heat-inactivated horse serum for 60 min and 10 mg/ml bovine serum albumin (Sigma-Aldrich, St. Louis, MO) in HEPES buffer for 60 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... Separated proteins were transferred to polyvinylidenedifluoride membranes that were blocked in 5% non-fat milk or 5% BSA (Sigma-Aldrich, St. Louis, MO, USA) in Tris-buffered saline with 0.1% Tween 20 (TBS-T) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sections were then incubated with the following primary antibodies diluted 1:200 in PBS overnight at 4°C: β-spectrin non-erythrocyte (hpa012685, Sigma, St. Louis, MO), collagen type II (ab34712 ...
-
Phospholipase C β4 promotes RANKL-dependent osteoclastogenesis by interacting with MKK3 and p38 MAPKbioRxiv - Cell Biology 2024Quote: The lentiviral constructs containing PLCβ4 small hairpin RNA (shRNA) or a non-specific shRNA control (Con-sh) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Lentiviral particles were generated by transfecting 293T cells with the expression constructs ...
-
bioRxiv - Cell Biology 2023Quote: Non-cornmeal molasses food was freshly made with or without 100 µM or 5 mM Phloroglucinol (PHG) (Sigma-Aldrich, CAS number 108-73-6) and solidified in a vial overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... or one of the following drugs or cocktails: the non-specific glutamate receptor agonist L-glutamic acid (600 nmol; Sigma Aldrich, St. Louis, MO), the V1aR antagonist (CH2)5Tyr(Me2)AVP (10ng) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed in CSM and resuspended in cisplatin for 5 min to label non-viable cells (Sigma, 0.5 μM final concentration in PBS). Cells were washed in CSM ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4.5 g/L glucose consisting of ∼20% [U-13C6]glucose and of 80% non-labelled glucose was added into glucose-free DMEM supplemented with 2 % horse serum (Sigma-Aldrich, H1138, NY, USA). Cells were incubated for 24 h with isotope-enriched media on day 3 post differentiation after which the media was collected ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... tccagagaagcctaaagtgat) or non-targeted control (shCont, Cat: SHC002) were generated in HEK293 cells using the Sigma Mission system (Sigma-Aldrich, St. Louis, MO USA). HUVECs were seeded into a 6-well dish at a density of 80,000 cells per well ...
-
bioRxiv - Immunology 2023Quote: ... bone marrow cells were obtained from femurs and tibiae of WT C57BL/6 mice by flushing with complete RPMI 1640 media containing 10% heat inactivated fetal bovine serum (FBS) (Sigma-Aldrich, non-USA origin). Red blood cells were lysed using ACK lysis buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... TrypLE Expres Enzyme activity was inactivated with the addition of pre-ice-chilled 200 ul 0.04% (m/v) non-acetylated BSA in DPBS (Sigma-Aldrich: B6917-100MG, Gibco: 14190144). The resulting cell suspension was underlayed with 200 ul of 1% non-acetylated BSA in HBSS (Sigma ...
-
bioRxiv - Plant Biology 2024Quote: ... The membrane was blocked in 5% non-fat milk in 1X TBST and detected with mouse monoclonal anti-HA (H9658, Sigma-Aldrich, St. Louis, MO) and anti-actin (A0480 ...
-
bioRxiv - Molecular Biology 2021Quote: ... (COVID-19 case and a control lung tissue of a non-smoker subject) were stained in silanized slides (Sigma Chemical Co. St. Louis, Missouri, EUA). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Unspecific antibody binding was prevented by incubating the blots in blocking solution containing 5% non-fat milk or 5% BSA (Sigma-Aldrich, St. Louis, MO, USA) in 1x Tris-buffered saline with 0.1 % Tween 20 (TBST ...
-
bioRxiv - Neuroscience 2019Quote: The following drugs were used for behavioral pharmacology experiments: the non-selective β-adrenergic receptor (βAR) antagonist DL-propranolol hydrochloride (Sigma-Aldrich, St. Louis, MO), the α1AR antagonist prazosin hydrochloride (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... The blot was blocked in 5% non-fat milk in TBS-T and probed with primary antibodies mouse monoclonal anti-parvalbumin (Sigma-Aldrich Cat# P3088, 1:2000) and mouse monoclonal anti-β-actin (Sigma-Aldrich Cat# A5441 ...
-
bioRxiv - Cell Biology 2022Quote: ... Corresponding secondary HRP-conjugated anti-rabbit (1:3000 or 1:2000 in 5% non-fat milk or 5% BSA/TBS-T; Sigma-Aldrich, St. Louis, MO, USA) was used for a 1-hour incubation at room temperature ...
-
bioRxiv - Genetics 2024Quote: ... quantification in the heads of both starved and non-starved miR-210 KO and WT flies was carried out using the Triglyceride Quantification Kit (Sigma-Aldrich, St. Louis, Missouri, USA), following the provided manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by blocking the non-specific binding sites with PBS supplemented with 1%v/v bovine serum albumin (BSA) (Sigma Aldrich, St. Luis, MO, USA). The cells were then incubated with primary antibody rabbit anti-YAP1 (1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-adherent cells were removed after 2 days and replaced with complete medium with ascorbic acid (100 μg/mL, Sigma-Aldrich, St. Louis, MO, USA). The media was replaced with fresh complete media with ascorbic acid every other day ...
-
bioRxiv - Immunology 2023Quote: ... The membranes were blocked with 5% (wt/vol) non-fat dry milk powder in TBS-T and probed with primary antibodies against the following targets: Flag (Sigma, F3165, 1:2000, mouse, monoclonal), anti-β-tubulin (Abcam ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were then washed and incubated with the appropriate secondary antibody in 5% non-fat dry milk in PBST for 2h at RT and revealed in Chemiluminescent HRP Substrate (Sigma Aldrich, Saint Quentin Fallavier, France).
-
bioRxiv - Neuroscience 2024Quote: ... we used a mix of two shRNA clones targeting two different sequences of the Phox2b mRNA carried by a non-replicating lentivirus vector (1x109 VP/ml; TRCN000041283: GCCTTAGTGAAGAGCAGTATG and TRCN0000096437: CCTCTGCCTACGAGTCCTGTA; Sigma Aldrich, St. Louis, MA, USA). The shRNAs were designed against the Phox2b mouse sequence (Ref Seq NM_008888 ...
-
bioRxiv - Biochemistry 2024Quote: ... the chamber was rinsed three times with T50 to remove non-specific interactions and a protocatechuic acid/recombinant protocatechuate-3,4-dioxygenase (Sigma Aldrich and Oriental Yeast Co., respectfully) (PCA/rPCD ...
-
bioRxiv - Cell Biology 2022Quote: The cellular health of Eca EPCs Non-OB and Eca EPCs OB was evaluated using Guava® Muse® Cell Analyser (Sigma-Aldrich/Merck, Poznan, Poland). The metabolic activity of cells was determined based on mitochondrial membrane potential using Muse™ Mitopotential Assay Kit ...
-
bioRxiv - Biophysics 2020Quote: ... and KCa (apparent calcium affinity) were determined based on non-linear least-squares fitting of the activity data to the Hill equation (Sigma Plot software, SPSS Inc., Chicago, IL). Errors were calculated as the standard error of the mean for a minimum of four independent reconstitutions.
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies were detected with a horseradish peroxidase (HRP)-conjugated secondary antibody (1:3000, #170-6515, Biorad or #12-349, Merck Millipore, in 1x TBS-T with 5 % non-fat dry milk) using enhanced chemiluminescence (ECL ...