Labshake search
Citations for Millipore Sigma :
1401 - 1450 of 1463 citations for Non Ab Component of Alzheimer's Disease Amyloid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... The precultures were washed three times with DBM medium without carbon source and inoculated in the same medium but replacing the non-labeled carbon source with 13C-sodium formate (Sigma-Aldrich Co.), 1-13C-sodium acetate (Cambridge Isotope Laboratories Inc. ...
-
bioRxiv - Systems Biology 2023Quote: Non-replicating shRNA lentivirus were generated in HEK293FT cells transfected with MISSION plasmids procured from Sigma-Aldrich (details in Supplementary Table 2). Transfection involved the combination of MISSION plasmid (6 µg) ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell death was quantified based on the abundance of lactate dehydrogenase (LDH) between treated and non-treated samples (MAK066, Sigma-Aldrich, USA). Absolute LDH content was determined with a standard curve ...
-
bioRxiv - Cell Biology 2022Quote: ... to block non-specific staining and incubated with a mouse anti-acetylated tubulin antibody (Clone 6-11b-1, 1:100; Sigma Cat# T6793) for 4 h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... the membranes were incubated at room temperature for 1 hour in TBS with 0.1 % Tween 20 (TBST) containing 5 % non-fat dry milk (Sigma Aldrich; #70166-500G). The membranes were incubated with AC patient IgGs ...
-
bioRxiv - Developmental Biology 2023Quote: ... After blocking non-specific binding in 2% non-fat milk in 0.1 M PBS containing 0.1% Triton X-100 (PBS/MT; X-100, Sigma Aldrich, St. Louis, MO), the organs were incubated in goat anti-Shh primary antibody (Table 1 ...
-
bioRxiv - Immunology 2023Quote: ... cells were transfected with either non-targeting siRNA or si-Adipor1 or si-Adipor2 plasmid using lipofectamine 3000 reagents (Sigma-Aldrich, USA) as per manufacturer protocol ...
-
bioRxiv - Immunology 2023Quote: ... 110-HG) in the presence or absence of 1 μg mCD152/Fc (CTLA4-Ig, mouse IgG2a, non-cytolytic) chimera (Sigma-Aldrich, C4358). The anti-human IgG Fc Antibody (BioLegend ...
-
bioRxiv - Bioengineering 2023Quote: ... 10-month-old A53T and non-transgenic littermate brain samples were homogenized in PBS with a protease inhibitor cocktail (Sigma Aldrich, 11873580001) using a 1:3 dilution of tissue:PBS (w/v) ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes with muscle tissue homogenates were blocked in 5% non-fat dry milk in TBS/0.2% Triton X-100 and incubated overnight in Tau12 (Millipore Sigma; 1:1000) and actin primary antibody (Millipore Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... Medium-containing recombinant lentiviruses were collected 48 and 72 hours after transfection and filtered through non-pyrogenic filters with a pore size of 0.45 mm (Merck Millipore, Billerica, MA, USA). Samples of these supernatants were applied immediately to target cells together with Polybrene (Sigma-Aldrich ...
-
bioRxiv - Genetics 2024Quote: ... We selected for a 75-25 enrichment of neuronal vs non-neuronal nuclei during FACS sorting using NeuN-488/DAPI counterstains (Millipore Sigma MAB377X). Bisulfite conversion and single cell methylome libraries were generated following this step.
-
bioRxiv - Cell Biology 2024Quote: ... the first image was captured under non-stimulation condition and subsequently 10 μL PBS buffer containing 500 μM PMA (P8139, Sigma-Aldrich, USA) was added into the dish carefully ...
-
bioRxiv - Cancer Biology 2024Quote: Custom Lentiviral shRNA USP50 sequence (based on the USP50-7 siRNA sequence C UAC CCA GCA UUU ACG) or non-targeting control sequence cloned into the pLKO-puro-IPTG-3xLacO vector were made by Sigma-Aldrich (Merck). Flp-InTM HeLa cells were lentivirally infected with NTC or USP50 shRNA as per the manufacturer‘s protocol and then cells selected using Puromycin ...
-
bioRxiv - Microbiology 2019Quote: ... The Isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible lentiviral backbone pLKO-puro-IPTG_3xLacO harboring the non-mammalian shRNA control was purchased (Mission™SHC332; Sigma Aldrich, Buchs, Switzerland). The puromycin resistance gene was replaced via restriction digestion cloning using a PCR-amplified fluorescent mCherry marker containing overhangs with compatible restriction sites to generate the pLKO-mCherry_IPTG_3xLacO lentiviral backbone.
-
bioRxiv - Microbiology 2020Quote: The MILLIPLEX MAP Non-Human Primate Cytokine Magnetic Bead Panel - Premixed 23 Plex – Immunology Multiplex Assay (Millipore, Burlington, MA, USA; #PCYTMG-40K-PX23) was performed on collected plasma samples following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... or without (non-inducing) 0.5% galactose in a microtiter plate sealed with an air-permeable membrane (Breathe-Easy; Sigma-Aldrich, St. Louis, MO) in n=6 replicates ...
-
bioRxiv - Cell Biology 2020Quote: Equal amounts of lysed proteins were separated by 7.5% or 10% SDS-polyacrylamide gels (under reducing conditions for CX3CR1 and non-reducing for total AAT or AAT polymer analysis) prior to transfer onto polyvinylidene difluoride (PVDF) membranes (Meck-Millipore, Burlington, MA, USA). Membranes were blocked for 1 h with 5% low fat milk (Carl Roth ...
-
bioRxiv - Biochemistry 2022Quote: ... and 78.1 µL of a 10 mg/mL (1R,8S,9s)-Bicyclo[6.1.0]non-4-yn-9-ylmethyl N-succinimidyl carbonate (BCN, 17 eq.) (Sigma Aldrich, Cat. No. 744867-10MG) and stirred at 4°C for 16 h ...
-
bioRxiv - Microbiology 2022Quote: ... at RT for 1 h to prevent non-specific staining and afterwards stained with 50 nM Halo-CF647 in PEMBAL buffer (1x PEM containing 3% BSA (Sigma-Aldrich, #A8549-10MG), 0.1% NaN3 (Carl Roth ...
-
bioRxiv - Microbiology 2020Quote: Levels of cytokines/chemokines in macaque plasma were measured using the Milliplex MAP non-human primate cytokine panel and Luminex 200 (Millipore Corp., Billerica, MA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... SH-SY5Y and Hep G2 cells were maintained in DMEM with 1 % of MEM Non-essential Amino Acid Solution 100x (NEAA) (Sigma Cat. No: M7145), SuBK12-08 and Tb 1 Lu in Eagle’s Minimum Essential Medium (EMEM ...
-
bioRxiv - Immunology 2020Quote: ... For intracellular cytokine staining B cells were activated or non-activated with anti-IgM/CpG in the presence of 5 mg/mL brefeldin A (BFA, Sigma, catalogue number: B6542) to prevent cytokine release ...
-
bioRxiv - Pathology 2022Quote: ... 1% penicillin/streptomycin and 1% MEM Non-essential Amino Acid Solution (all three reagents were purchased from Sigma-Aldrich, St. Louis, MO, USA). Cells were cultured at a density lower than 1 × 106/ml to ensure logarithmic growth.
-
bioRxiv - Cell Biology 2023Quote: ... 1 ml of differentiation medium (10% FBS (Millipore, Cat.No. ES-009-B, 1X L-Glutamine (Thermo Fisher, Cat.No.25030081, 1X Non-Essential AA, Millipore, Cat.No. TMS-001-C), 0.15 mM 2-Mercaptoethanol (Millipore ...
-
bioRxiv - Cancer Biology 2023Quote: The custom constructs for sh-TBX2 and its non-targeting scrambled RNA duplex siRNA control (NTSCR) was procured from sigma Aldrich (RNAi single clones, Millipore sigma, Burlington, MA). These lentiviral constructs along with packaging plasmid (pCMV delta R8.2 dvpr ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 plasmids containing shRNAs targeting KCNN4 and control non-target sequences (Supplementary Table 1) were obtained from Sigma-Aldrich (St Louis, USA) and transfected into HEK293T cells with a packaging mix that contains a pCMV-dR8.91 (Delta 8.9 ...
-
bioRxiv - Cell Biology 2023Quote: ... Manipulations of peptide/protein on planar glass-supported lipid bilayer was achieved by incubation in high salt concentration (20mM HEPES 150mM NaCl, for 10 min at room temperature) or non-labelable streptavidin (10μg/mL, Sigma-Aldrich, Cat No. 189730). For His6x-TLR2-ID-FLAG ...
-
bioRxiv - Biochemistry 2023Quote: ... To make the calibration curves a non-labelled amino acid mixture was made from an analytical amino acid standard without glutamine and asparagine (Sigma-Aldrich, A9906-1ML) and added glutamine (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... S-IRA was evoked in non-primed DBA/1 mice by IP administration of a single dose of PTZ (Cat #P6500; Sigma-Aldrich, St. Louis, MO) at a dose of 75 mg/kg ...
-
bioRxiv - Neuroscience 2020Quote: ... S-IRA was evoked in all non-primed DBA/1 mice by the IP administration of a single dose of PTZ (Cat # P6500; Sigma-Aldrich, St. Louis, MO) at a dose of 75 mg/kg ...
-
bioRxiv - Neuroscience 2022Quote: ... S-IRA was also established in all non-primed DBA/1 mice by IP administration of a single dose of PTZ (Cat #P6500; Sigma-Aldrich, St. Louis, MO) at a dose of 75 mg/kg.
-
bioRxiv - Microbiology 2022Quote: Levels of cytokines/chemokines in macaque plasma were measured using the Milliplex MAP Non-human Primate Cytokine Panel in combination with a Luminex 200 (Millipore Corp., Billerica, MA, USA) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... the cell suspension was poured twice more and inserted into a tunnel chamber which was assembled by taping coverslips cleaned with saturated ethanolic KOH and precoated with 100% non-heat-inactivated horse serum for 60 min and 10 mg/ml bovine serum albumin (Sigma-Aldrich, St. Louis, MO) in PBS for 60 min at RT ...
-
bioRxiv - Neuroscience 2019Quote: ... They were fed with the same neuron chow and proliferation of non-neuronal cells was arrested by the addition of 1 µM cytosine arabinoside (Sigma-Aldrich, St. Louis, MO) at DIV 5 ...
-
bioRxiv - Genomics 2021Quote: ... Serum samples obtained from vaccinated and non-vaccinated individuals were stored at −20°C until tested treated with receptor destroying enzyme (RDE) (Sigma C8772, diluted 1:4), for 16 h prior to heat inactivation (30 min ...
-
bioRxiv - Physiology 2021Quote: ... Parametric and non-parametric tests were used based on results from normality (Shapiro-Wilk) and equal variance (Brown-Forsythe) tests (Sigma Plot v.13, Systat). All data are shown as mean ± SD or scatter plots with bars indicating group means ...
-
Force and stepwise movements of gliding motility in human pathogenic bacterium Mycoplasma pneumoniaebioRxiv - Microbiology 2021Quote: ... which was assembled by taping coverslips cleaned with saturated ethanolic KOH and precoated with 100% non-heat-inactivated horse serum for 60 min and 10 mg/ml bovine serum albumin (Sigma-Aldrich, St. Louis, MO) in HEPES buffer for 60 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... Separated proteins were transferred to polyvinylidenedifluoride membranes that were blocked in 5% non-fat milk or 5% BSA (Sigma-Aldrich, St. Louis, MO, USA) in Tris-buffered saline with 0.1% Tween 20 (TBS-T) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... incubated with increasing concentrations of unlabelled peptides (D5, TPD5, mPD5) using black half-area Corning non-binding surface 96 well plates (Sigma-Aldrich, Ref. no. 3686). The plates were incubated 20 min on ice and the fluorescence polarization was measured on an Omega POLARstar plate (BMG LABTECH ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sections were then incubated with the following primary antibodies diluted 1:200 in PBS overnight at 4°C: β-spectrin non-erythrocyte (hpa012685, Sigma, St. Louis, MO), collagen type II (ab34712 ...
-
bioRxiv - Neuroscience 2023Quote: ... or one of the following drugs or cocktails: the non-specific glutamate receptor agonist L-glutamic acid (600 nmol; Sigma Aldrich, St. Louis, MO), the V1aR antagonist (CH2)5Tyr(Me2)AVP (10ng) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed in CSM and resuspended in cisplatin for 5 min to label non-viable cells (Sigma, 0.5 μM final concentration in PBS). Cells were washed in CSM ...
-
bioRxiv - Developmental Biology 2023Quote: ... TrypLE Expres Enzyme activity was inactivated with the addition of pre-ice-chilled 200 ul 0.04% (m/v) non-acetylated BSA in DPBS (Sigma-Aldrich: B6917-100MG, Gibco: 14190144). The resulting cell suspension was underlayed with 200 ul of 1% non-acetylated BSA in HBSS (Sigma ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... tccagagaagcctaaagtgat) or non-targeted control (shCont, Cat: SHC002) were generated in HEK293 cells using the Sigma Mission system (Sigma-Aldrich, St. Louis, MO USA). HUVECs were seeded into a 6-well dish at a density of 80,000 cells per well ...
-
bioRxiv - Immunology 2023Quote: ... bone marrow cells were obtained from femurs and tibiae of WT C57BL/6 mice by flushing with complete RPMI 1640 media containing 10% heat inactivated fetal bovine serum (FBS) (Sigma-Aldrich, non-USA origin). Red blood cells were lysed using ACK lysis buffer ...
-
bioRxiv - Cell Biology 2023Quote: Non-cornmeal molasses food was freshly made with or without 100 µM or 5 mM Phloroglucinol (PHG) (Sigma-Aldrich, CAS number 108-73-6) and solidified in a vial overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4.5 g/L glucose consisting of ∼20% [U-13C6]glucose and of 80% non-labelled glucose was added into glucose-free DMEM supplemented with 2 % horse serum (Sigma-Aldrich, H1138, NY, USA). Cells were incubated for 24 h with isotope-enriched media on day 3 post differentiation after which the media was collected ...
-
Phospholipase C β4 promotes RANKL-dependent osteoclastogenesis by interacting with MKK3 and p38 MAPKbioRxiv - Cell Biology 2024Quote: The lentiviral constructs containing PLCβ4 small hairpin RNA (shRNA) or a non-specific shRNA control (Con-sh) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Lentiviral particles were generated by transfecting 293T cells with the expression constructs ...
-
bioRxiv - Molecular Biology 2021Quote: ... (COVID-19 case and a control lung tissue of a non-smoker subject) were stained in silanized slides (Sigma Chemical Co. St. Louis, Missouri, EUA). Briefly ...