Labshake search
Citations for Millipore Sigma :
1401 - 1450 of 2519 citations for ssc mir 376c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from approximately 100mg flash-frozen liver tissue following homogenization in RNAzol RT reagent (Sigma-Aldrich). cDNA was synthesized from 1ug RNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated for 30 minutes at RT in a homemade Click reaction mixture containing 4 mM CuSO4·5H2O (Sigma), 4 μM Alexa Fluor-647-conjugated azide (ThermoFisher) ...
-
bioRxiv - Physiology 2022Quote: ... Cells were subsequently washed with PBS and incubated with 1.5 mg/ml glycine (Sigma-Aldrich, 10 min at RT) to quench unreacted paraformaldehyde followed by washing with PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... the zebrafish larvae were permeabilized for 1h at RT with a blocking buffer [5% BSA (A9647-10G, Sigma-Aldrich), 5% sheep serum (013-000-1210 ...
-
bioRxiv - Cell Biology 2023Quote: ... specimens were prepared in PBS and subsequently fixed for 4 h at RT in fixative (2% glutaraldehyde (Sigma, Germany)/ 4% paraformaldehyde (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... with the following changes: 90 minute primary antibody incubation at RT (rabbit α-GST, Sigma Aldrich #G7781, 1:4000) and 30 minute secondary incubation at RT (goat α-rabbit HRP ...
-
bioRxiv - Molecular Biology 2023Quote: ... The signal was developed by incubation with DAB (3,3′-diaminobenzidine) for 10 minutes at RT and counterstained with hematoxylin (Sigma), followed by a wash in 0.02% ammonia water before mounting ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were initially blocked for 2 hours at room temperature (RT) with PBS-T 0.05% containing 10% of a donkey or goat Serum (Sigma). Primary antibodies ...
-
bioRxiv - Immunology 2023Quote: ... and secondary antibodies were diluted in IF buffer and incubated for 1 hour at RT and washed 3 more times with PBS 0.05% Tween20 (Sigma). Sections were incubated with PBS DAPI (5 µg/mL ...
-
bioRxiv - Immunology 2023Quote: ... and fixed for 3 hr at room temperature (RT) in freshly prepared Carnoy’s fixative [60% anhydrous methanol (Sigma-Aldrich), 30% chloroform (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the membrane was incubated for 1 h at RT with secondary AP-conjugated anti-mouse or anti-rabbit antibodies (1:20,000, Sigma), washed three times for 5 min with PBT and once for 15 min in 20 mM Tris-HCl (pH 9.8 ...
-
bioRxiv - Immunology 2023Quote: ... for 20 min in the dark RT and washed with 100 mM ammonium bicarbonate (NH4HCO3) (09830-500G, Sigma-Aldrich) and dehydrated as above ...
-
bioRxiv - Immunology 2023Quote: ... or LIVE/DEAD™ Fixable Blue Cells Stain Kit (#L34957, Thermo; 1:1000 in PBS) and fixation for 15 minutes at RT using 1.85% formaldehyde (F1635, Sigma) in PBS solution before surface staining with antibodies in PBS supplemented with 0.5% BSA [fraction V ...
-
bioRxiv - Cell Biology 2023Quote: ... BMDMs were crosslinked with 0.4% paraformaldehyde for 10 minutes at room temperature (RT) and immediately quenched with 0.125 M glycine (Millipore Sigma) for 5 minutes at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... were added and incubated for 2 h at RT on shaker followed by 3x washes in 0.1% TritonX100 (Sigma) in PBS (Gibco).
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Samples were centrifuged (15,000 rpm, 10 min, RT) and the supernatants were transferred into glass vials containing MTBSTFA (70 μl, Sigma) for derivatization at 70 °C for 1 h ...
-
bioRxiv - Genetics 2023Quote: ... The seminiferous tubules were incubated for 60 min at RT in fixation buffer (100 mM HEPES pH7.4, 4 mM CaCl2, 2.5% glutaraldehyde, 2% PFA, all from Sigma Aldrich) and then the buffer was exchanged with fresh fixation buffer and the samples left overnight fixed at 4 °C ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... PFA was subsequently quenched with 500 mM NH4Cl for 10 min at RT and then cells were permeabilized with 0.1% Triton-X-100 (Sigma) for 10 mins at RT ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were blocked with 5% BSA in PBS for 1 hour at RT and incubated overnight at 4°C with primary antibodies diluted in 0.5% BSA/1% Tween-20 (Sigma) in PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... for 10 min at room temperature (RT) and permeabilized for 5 min in 0.5% Triton X-100 (#T9284, Sigma) with 2 mM VRC diluted in PBS on ice ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated and inverted for 10 min at RT with ammonium chloride lyse [NH4Cl 155 mM (Sigma Aldrich), NaHCO3 10 mM (Sigma Aldrich) ...
-
bioRxiv - Plant Biology 2024Quote: ... After immunolabeling the coverslips were incubated in Acryloyl-X-SE 0.1 mg/mL in PBS (ThermoFischer) overnight at RT and then in the monomer solution (11.7% NaCl, 3 % acrylamide (Sigma), 0.15% N,N′-methylenebisacrylamide (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... 4%) for 30 min at RT followed by a permeabilization step by using Triton X-100 (0.1%; Sigma-Aldrich) for 15 min at RT or Tween-20 (0.1% ...
-
bioRxiv - Biophysics 2019Quote: ... The DNA encoding AtGLR3.2 residues Ser420-V572 (S1) and P682-N811 (S2) was amplified using gene-specific primers and subcloned into the pET22b vector (Novagen) between NcoI and XhoI sites with a GT linker between S1 and S2 (Armstrong and Gouaux ...
-
bioRxiv - Immunology 2021Quote: ... was incubated with 1 µl 10 µM random pentadecamers (IDT 169190224) and 0.5 µl 100µM anchored oligo(dT)20 primer (Sigma, custom synthesized) at 65°C for 5 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was extracted and resuspended in RNase free water then added to primer extension buffer containing 7mM MgOAc (Sigma-Aldrich), 100mM KOAc (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2020Quote: ... and His6-tagged GFP gene (primers A18 and 19; Table S1) were separately cloned using InFusion (Clonetech) methods into NdeI/BamHI-linearised pET19b (Novagen).
-
bioRxiv - Molecular Biology 2019Quote: ... Samples were mixed with 3 μl of 2μM fluorescent primer (D4-5′-TTTCTTTCCCCCTGGCCTT for the probed/control samples and D2-5′-TTTCTTTCCCCCTGGCCTT for the sequencing reaction, Sigma) and incubated for 5 minutes at 65°C ...
-
bioRxiv - Biochemistry 2019Quote: ... was amplified by PCR from a stock of Phi29 phages using primers 5’ACCATGGATCCCATATGCCGAGAAAGATGTATAG3’ and 5’ACCATGAATTCTCGAGTTATTTGATTGTGAATGTG3 (restriction sites underlined) and cloned into the NdeI and EcoRI sites of pET28a (Novagen) introducing a N-terminal His6-tag ...
-
bioRxiv - Immunology 2019Quote: ... RNF144A cDNA was amplified using primers CGAGATCTGATGACCACAGCAAGGTACCGG (P3) and CCGGTCGACGCGCTTCCTCTAGGTGGGTAACGG (P4) and cloned into BglII and SalI sites of pFlag-CMV2 (Sigma). FLAG-RNF144A C198A was generated by site-directed mutagenesis using Quickchange (Stratagene ...
-
bioRxiv - Cancer Biology 2019Quote: ... Desired constructs were amplified from the complete RNF114 sequence with primers that contained 20 base pairs of homology to a pET24a plasmid (Novagen) that had been modified to contain a His8-MBP-TEV sequence between the Nde1 and BamH1 restriction sites ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the PCR fragment was amplified with the primers detailed in Supplementary Table 1 and purified in MultiScreen TM Vacuum Manifold 96-well plates (Merck Millipore). The purified PCR fragment was incubated with either the enzyme NlaIII or water (negative control ...
-
bioRxiv - Immunology 2021Quote: PCR was used to amplify EtMIC3 DNA from the pET22b MIC3 plasmid using primers (F: GCTATCGGATCCCAAGCCGTTCCAGAGG, R: CTGCGAGAATTCGCCACTTGGATCTTCCGTT, 0.4 μM final concentration, Sigma Aldrich) that incorporated appropriate restriction enzyme sites (Bam HI and Eco RI ...
-
bioRxiv - Plant Biology 2020Quote: ... the full-length Sl-AACS ORF sequence was amplified using the primer pair SlAACS1-pET28_F/R (table S3) and was cloned into pET28b (EMD Millipore) using the Gibson assembly kit (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... codon optimized for expression in Sf9 insect cells (Table S4)) with primers BA2117/BA2118 and cloned into the RSFDuet-1 vector (Novagen) using BamHI/EcoRI sites with an NEBuilder HiFi DNA Assembly Cloning Kit (NEB ...
-
bioRxiv - Microbiology 2022Quote: Genes for pbps were amplified with Phanta Max Super-Fidelity DNA Polymerase (Vazyme) and primers ordered from Sigma (Table S2). Equimolar quantities of PCR products were used for transformation ...
-
bioRxiv - Biochemistry 2022Quote: DNA encoding the appropriate genes (excluding the signal sequences) were amplified from genomic DNA using appropriate primers and cloned into pET28b (Novagen). Recombinant plasmids were transformed into TUNER (Novagen ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.4 mM dNTPs mix, 10 x primer master mix (1.6 µM FIP / BIP, 0.2 µM F3 / B3) (Sigma, HPLC purified), 1 x EvaGreen dye (Biotium) ...
-
bioRxiv - Biochemistry 2021Quote: ... bacteriovorus HD100 genomic DNA using primers detailed in Table S1 Amplified construct DNA was inserted into a modified pET41c plasmid (Novagen, GST-tag removed and thrombin cleavable 8xHis-tag introduced at C-terminus ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA fragment containing the entire protein encoding ORF of PSMA5 was amplified with a forward primer containing a EcoRI site (5’-TTTT GAATTC ATG TTT CTT ACC CGG TCT GAG TAC GAC-3’, Sigma) and a reverse primer containing sequences specifying an FLAG tag ...
-
bioRxiv - Biochemistry 2021Quote: ... Gene was amplified using a high-fidelity polymerase with primers specifically designed to perform Gibson assembly in BamH I and Xho I digested pET28a vector (Novagen), to express gene with N-terminal (His ...
-
bioRxiv - Genetics 2020Quote: ... CRISPR-targeted regions were amplified with MiSeq-compatible gene-specific primers containing Read1 and Read2 adaptor sequences (IDT) using KOD DNA polymerase Hot start kit (TOYOBO/Millipore). The second PCR was performed with index adaptor primers compatible with Ilumina MiSeq (i5 and i7 primers ...
-
bioRxiv - Microbiology 2021Quote: The chvI and mirA coding sequences (wild type and mutant alleles) were amplified from cloning constructs (primer sequences in Table 2) and ligated into pET-28a(+) (Novagen/ EMB Biosciences/ Millipore). Protein-expression plasmids were transformed into E.coli Top10 F’ for collection and sequence verification and then transformed into E.coli BL21/λDE3 for expression and protein purification ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid cDNA barcode sequences were amplified using primers containing indexed Illumina sequencing adaptors (Extended Data Table 10) using KOD Hot Start DNA Polymerase (Novagen). Amplicons were purified using Agencourt AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid pET-StbA1-75 was constructed by amplifying the truncated stbA gene encoding the first 75 residues of StbA by PCR from plasmid R388 using primers StbAN and StbA75 and introduced between the NdeI and XhoI restriction sites of pET29c (Novagen). Plasmid R388-StbA1-75 was constructed in two steps by replacement of the stb operon in R388 (Table S1 ...
-
bioRxiv - Neuroscience 2022Quote: Quantitative PCRs were run using qPCRBIO SyGreen mix separate-Rox (cat #: PB20.14-51 PCRBIOSYSTEMS) and specific primers (Table 1; Table 2) or Gapdh as housekeeping gene (Sigma-Aldrich), on a LightCycler 96 Real-Time PCR System (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.4 mM dNTPs mix, 10 x primer master mix (1.6 µM FP / RP, 0.8 µM IF / IB) (Sigma, HPLC purifed), 1 x EvaGreen dye (Biotium) ...
-
bioRxiv - Molecular Biology 2023Quote: The substrates for PolA synthesis experiments were done by annealing three (gap substrate) or two (primer extension substrate) HPLC purified oligos (Sigma) in a thermocycler ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...