Labshake search
Citations for Millipore Sigma :
1301 - 1350 of 2519 citations for ssc mir 376c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... the membranes were incubated for 30 min at RT with anti-β-actin (1:10’000, A3854 Sigma-Aldrich), which is used as a normalizer.
-
bioRxiv - Genomics 2019Quote: ... blots were rinsed three times in PBS and incubated for 10min at RT in 0.02% methylene blue (Sigma) in 0.3M sodium acetate ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by incubation for another 1 hour at RT in a solution containing 2.5% potassium ferrocyanide (Sigma-Aldrich) in 0.1 M PIPES ...
-
bioRxiv - Cell Biology 2022Quote: ... and fixed 10 minutes at RT in fixation buffer (10% formaldehyde solution, Sigma Aldrich, in nuclease free water). Cells were washed 2 x and permeabilized O/N in 70% ethanol at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed with 2% paraformaldehyde for 15 min at RT then permeabilised using 0.5% saponin (Sigma-Aldrich) and stained for 30 min at 4°C for the following intracellular markers ...
-
bioRxiv - Neuroscience 2022Quote: ... containing coverslips were fixed for 20 min at room temperature (RT) in 4% (w/v) paraformaldehyde (PFA, Sigma) in 0.15 M phosphate buffer (potassium dihydrogen phosphate (Merck ...
-
bioRxiv - Pathology 2023Quote: Liver and renal cortex RNA from EU-exposed mice were extracted using RNAzol RT reagent (Sigma-Aldrich, # R4533). The incorporated EU was detected by click chemistry biotinylation and dot blotting ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tissue was then subjected to the following washes at RT with agitation: 125 mM SB-10 (Sigma D4266) in 50 mM sodium/10 mM phosphate buffer (VWR BDH9286 ...
-
bioRxiv - Cell Biology 2023Quote: ... optionally pre-coated at RT for 20min with 20μl of 0.2mg/ml in DDW concanavalin A (L7647, Sigma) and air-dried.
-
bioRxiv - Cell Biology 2023Quote: ... and blocked for 1 hour at RT in 3% BSA (Applichem) in PBS-Tween buffer (0.01%) (ThermoFisher, Sigma). The membranes were then incubated overnight at 4°C with primary antibodies listed in the Supplemental table 3 with agitation ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were washed and incubated 1 h at RT with peroxidase-conjugated secondary antibodies (anti-mouse, Sigma-Aldrich Cat# A4416 ...
-
bioRxiv - Molecular Biology 2023Quote: ... staining, immunoselected transcripts were on-bead digested (10 min, RT) with 2 µL 10 µg/mL RNaseA (Sigma), separated by UREA-PAGE ...
-
bioRxiv - Immunology 2023Quote: ... coverslips were washed with PBS for 2 minutes at RT and mounted with Mowiol 40-88 (Sigma-Aldrich). Confocal microscopy images were acquired using a Zeiss LSM 880 instrument ...
-
bioRxiv - Immunology 2023Quote: ... coverslips were washed with PBS for 2 minutes at RT and mounted with Mowiol 40-88 (Sigma-Aldrich). Confocal microscopy images were acquired using a Zeiss LSM 880 instrument ...
-
bioRxiv - Immunology 2023Quote: ... during 5 minutes at RT followed by blocking with 10 μg/mL human γ-globulin (Sigma-Aldrich, USA) in TBS-0.5% blocking reagent (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... fixed with 0.5% glutaraldehyde and incubated for 3 min at RT with 5 mg/ml sodium borohydride (Sigma). After washes ...
-
bioRxiv - Microbiology 2024Quote: ... Some antibodies used were directly coupled to HRP and incubated 1 h at RT (FLAG-HRP, Sigma-Aldrich, A8592 ...
-
bioRxiv - Cell Biology 2023Quote: ... for 10 min at RT and then permeabilized for 3 minutes with 0.2% Triton-X 100 (Millipore Sigma). Over-extracted cells were treated with 0.4% Triton-X 100 for 10 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and a biotinylated donkey anti-rabbit immunoglobulin G secondary antibody (1:1,000 for 2 hours at RT; Millipore). To eliminate nonspecific binding prior to immunostaining endogenous peroxidase activity was blocked using 0.3% H2O2 for 30 min at room temperature (RT) ...
-
bioRxiv - Immunology 2019Quote: ... Primers were designed using Primer3 software62 with sequences obtained from GenBank and synthesized by Sigma Aldrich (Table 3, 4). PCR reactions were performed on the LightCycler®480 Real Time PCR System (Roche ...
-
bioRxiv - Genomics 2019Quote: ... the extended sequencing primer is cleaved and stripped away with stripping buffer 80% (vol/vol) formamide (221198, Sigma-Aldrich) in H2O and 0.01% (vol/vol ...
-
bioRxiv - Microbiology 2020Quote: ... One microliter of the synthesized cDNA was mixed with 0.5 μl of 10 μM pre-mixed primer and SYBR Green JumpStart (Sigma) to reach a final volume of 10 μl ...
-
bioRxiv - Immunology 2022Quote: ... Primers were designed using Primer3 (82) with sequences obtained from GenBank and synthesized by Sigma Aldrich (Supplementary Table 1). PCR reactions were performed on the LightCycler® 480 Real Time PCR System (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 µl of the eluted DNA was mixed with the forward and reverse primers (Sigma; 100-500 nM each) and 1× PerfeCTa® SYBR® Green FastMix (Quantabio ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Plant Biology 2019Quote: ... 500-1200 nM primers mix (desalt purification, all provided by Sigma-Aldrich Chimie S.a.r.l France, Tables 1 and 2). qPCR mixtures were dispensed by SmartChip Multisample Nanodispenser (MSND ...
-
bioRxiv - Biochemistry 2021Quote: ... and the reverse primer with in frame Flag sequence 5’GTCTCTCGAGTTACTTGTCATCGTCATCCTTGTAATCTTTCTTTCTGTTGCCTCC3’ and cloned into the pcDNA3 Plasmid (Sigma Aldrich) using the restriction sites HindIII and Xho1.
-
bioRxiv - Microbiology 2021Quote: ... fragments of the target genes were obtained using the primers in Table S2 and subsequently cloned into pET21a (Novagen) or pGEX-6P-3 (GE Healthcare) ...
-
bioRxiv - Microbiology 2023Quote: ... The list of primers used for amplification is shown in supplementary table 2 (Sigma Aldrich, St. Louis, MO, USA). RecA was used to normalize the amount of cDNA while conducting RT PCR to measure expression levels of ten V ...
-
bioRxiv - Microbiology 2023Quote: ... ΔeutB and the various complemented strains in LMO All primers used in this study were purchased from Sigma-Aldrich and are listed in Table S2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Rats were screened for the presence of mutations by PCR using tail-tip DNA samples (RED extract-N-Amp Tissue PCR Kit, Millipore-Sigma) as described previously (1 ...
-
bioRxiv - Microbiology 2022Quote: ... 1.3×106 copies of the PCR product from the mixture above were added into the second round PCR (KOD Hot Start DNA Polymerase, Novagen) to add the adapter for sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... amplified by PCR with Phusion U Hot Start PCR MasterMix (Thermo-Fischer Scientific) in presence of 0.5 mM betaine (Sigma-Aldrich) using universal bacterial primers (27F 5’ AGAGTTTGATCCTGGCTCAG and 1492R 5’ GGTTACCTTGTTACGACTT ...
-
bioRxiv - Genetics 2021Quote: ... Purification of genomic Polymerase Chain Reaction (PCR) amplified DNA was performed with the GenElute PCR Clean-Up kit (Sigma-Aldrich) or the GeneJET PCR Purification Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... The painting probes were generated from the DOP-PCR amplified samples by a secondary DOP-PCR incorporation of biotin-dUTP and digoxigenin-dUTP (Sigma) [25] ...
-
bioRxiv - Neuroscience 2023Quote: ... The gDNA samples were then amplified by polymerase chain reaction (PCR) using ReadyMix(TM) Taq PCR Reaction Mix (P4600,Sigma) containing 12.5μL Reaction Mix (P4600 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 18bp of the reverse complement of the beginning of the DNA tag sequences was added to the 5’ of the reverse primer so that the CRM can be combined with the DNA tag in equal amount using overlap PCR (Xiong et al., 2006) using Expand High Fidelity PLUS PCR (Sigma). The resulting fragment was run on 2% agarose 1x TAE gel ...
-
bioRxiv - Genomics 2023Quote: ... neoformans parental strains or segregants was set up by picking a fungal colony from YPD agar plates (50g/L YPD broth powder [Sigma-Aldrich], 2% Agar [MP Biomedical]) and resuspending it in 3mL liquid YPD broth (50 g/L YPD broth powder [Sigma-Aldrich]) ...
-
bioRxiv - Microbiology 2020Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified 1,297 RT-PCR products were digested with MluI (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... The PCR products were cloned into pET21a (Novagen) using InFusion cloning technology ...
-
bioRxiv - Genomics 2020Quote: ... 1M betaine (PCR Reagent grade, Sigma-Aldrich, USA) and 0.667μM of each random primer (5’GTGAGTGATGGTTGAGGTAGTGTGGAGNNNNNTTT 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... and Expand high-fidelity PCR system (Sigma-Aldrich). RT-PCR products were purified on 0.7% agarose gel and subjected to Sanger sequencing (ACGT) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl of BioStabII PCR Enhancer (Sigma). For each sample ...
-
bioRxiv - Microbiology 2021Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified DNA products were subjected to 0.7% agarose gel analysis and the gel-purified PCR fragments were subjected to sanger sequencing (ACGT) ...
-
bioRxiv - Microbiology 2022Quote: ... and Expanded High Fidelity PCR system (Sigma Aldrich). Amplified DNA products were separated on a 0.7% agarose gel ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were first cloned in pET22b (Novagen; containing the N-terminal pelB sequence ...
-
bioRxiv - Cell Biology 2020Quote: ... After purification with PCR Cleanup kit (Sigma-Aldrich), nucleic acids were eluted in 100 μL of elution buffer (5 mM Tris-HCl pH 8.5 ...
-
bioRxiv - Microbiology 2021Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified DNA products were separated on a 0.7% agarose gel ...
-
bioRxiv - Genetics 2021Quote: ... using Expand Long Template PCR System (Sigma Aldrich). PCR primers were designed using the MEIS1 promoter as a viewpoint and included Truseq adapters ...
-
A pancreas specific Ptf1a-driven Cre mouse line causes paternally transmitted germline recombinationbioRxiv - Genetics 2020Quote: ... supplemented with 10ul PCR grade Proteinase K (Sigma) at 55°C ...