Labshake search
Citations for Millipore Sigma :
901 - 950 of 2519 citations for ssc mir 376c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Immunology 2022Quote: ... Each primer was designed using Primer3 software and synthesized to order by Sigma. For each gene ...
-
bioRxiv - Microbiology 2023Quote: ... The oligonucleotide primers used in this work (Table 2) were synthesized by Sigma Aldric ...
-
bioRxiv - Molecular Biology 2022Quote: ... Primers were all ordered as standard desalted oligos at 25 nmole scale (Sigma).
-
bioRxiv - Genomics 2023Quote: ... Primers containing Common Molecular Identifiers (CMI) were synthesised by Sigma Aldrich (Burlington, USA) using the following sequences polyA oligonucleotide ...
-
bioRxiv - Cancer Biology 2023Quote: ... primers and probe were designed by the assay design center from Sigma-Aldrich OligoarchitectTM since the UPL system was available until December 2020.
-
bioRxiv - Neuroscience 2023Quote: ... Reverse transcription was carried out at 37° C by random primers (Sigma-Aldrich) and Moloney murine leukemia virus (M-MLV ...
-
bioRxiv - Microbiology 2023Quote: All chemicals and primers were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise stated ...
-
bioRxiv - Microbiology 2023Quote: ... The oligonucleotide primers listed in Table 2 were custom-synthesized by Sigma Aldrich.
-
bioRxiv - Biochemistry 2023Quote: ... We cloned the BRCT and RING variant library by designing primers (Sigma-Aldrich) to amplify the C-terminal (residues 1,314-1,863 ...
-
bioRxiv - Molecular Biology 2024Quote: Primers were all ordered as standard desalted oligos at 25 nmole scale (Sigma). All oligo sequences can be found in Supplementary File 1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Necessary oligos and primers specified by online tool were ordered from Sigma Aldrich.
-
bioRxiv - Developmental Biology 2021Quote: ... and developed in Fast Red TR and naphthol-AS-MX-phosphate in 0.1 M Tris-HCl pH 8.2 (tablet set; Sigma). After three washes with PBT ...
-
bioRxiv - Neuroscience 2019Quote: ... pH set at 7.3-7.4 and osmolarity set at 325 mOsm) before being placed on Millicell cell culture inserts (Millipore) in 6-well plates containing culturing medium ...
-
bioRxiv - Microbiology 2020Quote: ... another set of induced cultures were treated with a ROS inducing 100µM MnTBAP (Sigma Aldrich, 55266-18-7) and incubated for 15 mins to prepare positive control ...
-
bioRxiv - Microbiology 2021Quote: ... Growth curves of final volume 200 µl were set up in 96-well Costar culture plate (Sigma Aldrich) and sealed inside an anaerobic chamber (Don Whitley Scientific ...
-
bioRxiv - Genetics 2019Quote: ... Corresponding pairs of complementary oligonucleotides (SET-CRSP-1.1 and SET-CRSP-1.2) and (poSET-CRSP-1.1 and poSET-CRSP-1.2) were ordered from Sigma-Aldrich and annealed to obtain double stranded SET-CRSP-1 and poSET-CRSP-1 fragments ...
-
bioRxiv - Neuroscience 2019Quote: ... washed 3×10 min in PBS-B and developed in diaminobenzidine tablets (DAB) (cat# D4418-50 SET; Sigma) for 3 min.
-
bioRxiv - Immunology 2021Quote: ... The treated glass was attached to a 64-well gasket (Grace Bio-Labs ProPlate tray set, Sigma-Aldrich) and washed thoroughly with DI water ...
-
bioRxiv - Bioengineering 2023Quote: Cell-free assays were set up manually in white flat bottom 96-well plates (BRANDplates®;Sigma-Aldrich) at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... coli were pelleted and resuspended in SET buffer (200 mM Tris, pH 8.0, 500 mM sucrose, 0.5 mM EDTA, 1X cOmplete protease inhibitor (Sigma)) for 30 minutes at room temperature ...
-
bioRxiv - Genetics 2021Quote: ... All PCR products were purified with GenElute PCR Clean-Up Kit (Sigma) and sent for Sanger sequencing (Microsynth ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR was performed using the Red Taq Ready PCR system (Sigma Aldrich) using primers described in Supplementary Table 2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR was performed using the REDExtract-N-Amp PCR Readymix (Sigma-Aldrich). The following primers were used for genotyping ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-qPCR was performed using SYBR-Green Mastermix with ROX reference dye (Sigma). A list of all primer sequences used can be found in Table 1 below ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were diluted 1:2 for RT-qPCR using SYBR Green Mastermix (Sigma) and primers detailed in Table 3.
-
bioRxiv - Developmental Biology 2021Quote: ... and 2 hrs at RT in blocking buffer containing anti-HA antibody (Sigma). After rinsing with PBS ...
-
bioRxiv - Physiology 2020Quote: ... Muscle powder was homogenized using RNAzol RT reagent (Sigma-Aldrich, St Louis, MO) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... at RT for 60 min and alkylated with 40 mM iodoacetamide (Sigma-Aldrich) at RT in the dark for 60 min ...
-
bioRxiv - Microbiology 2021Quote: ... blocked for 30 min at RT with 10% heat-inactivated goat serum (Sigma) in PBS−/− ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked for 1 hour at RT in a phosphoprotein blocker (Millipore) and probed for total (Cell Signaling ...
-
bioRxiv - Immunology 2020Quote: ... for 1 h at RT in microscopy buffer (5% w/V BSA (Sigma), 0,06% w/V saponin (Sigma ...
-
bioRxiv - Plant Biology 2019Quote: Reverse transcription (RT) was performed on total RNA extracted using Tri-Reagent (Sigma) from untreated and UV-C treated plants (time points 0 ...
-
bioRxiv - Cell Biology 2021Quote: ... and permeabilised for 20min at RT using PBS/0.25% Triton X-100 (Sigma). Cells were blocked for 30min at RT with blocking solution (PBS-0.25% Triton X-100 plus BSA 1%) ...
-
bioRxiv - Neuroscience 2022Quote: ... blocked for 1 hour at room temperature (RT) with 6% donkey serum (Sigma) + 0.3% Triton X-100 (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 % glycerol for GII RTs) with an Amicon Ultra-15 (30k) concentrator (Millipore) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... PBS pH 7.2) at RT for 1h and incubated with Acta2 antibody (Sigma) at 40C overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... blocked for 1 hour at room temperature (RT) with 6% donkey serum (Sigma) + 0.3% Triton X-100 (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... 24h later at least 1h at RT and stained with crystal violet (Sigma). PFU were counted from each dilution in order to determine the infectious titer (in PFU/mL ...
-
bioRxiv - Pathology 2023Quote: ... washed and fixed 8 h (RT) in 4% paraformaldehyde (P6148, Sigma Aldrich, USA). Tissues were embedded in Tissue-Tek OCT Compound (Sakura Finetek ...
-
bioRxiv - Pathology 2023Quote: ... for 60 min at RT and visualized using 3,3-diaminobenzidine (DAB) (Sigma, 11718096001) for 10 min at RT ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The tissues were stained overnight at RT using DAPI (1 µg/µl) (Sigma) diluted at 1× PBS.
-
bioRxiv - Bioengineering 2024Quote: ... and fixation initiated at RT in 10% neutral buffered formalin (NBF, Sigma-Aldrich), followed by fixation/storage at 4°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR-based (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2020Quote: ... SYBR green primers were designed in house and bought from Sigma-Aldrich (Gillingham, UK) corresponding to ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cancer Biology 2019Quote: ... Each sample was amplified in triplicate using custom-designed primers (Sigma, Supplementary Table 2) in a HT7900 Real Time PCR System using SensiMix SYBR-Green Mix (Bioline ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was quantified by using predesigned KiCqStart SYBR® Green primers (# KSPQ12012, Sigma Aldrich, sequences of the primers provided in supplementary table-1, ...
-
bioRxiv - Biochemistry 2020Quote: ... Primers used in this study were synthesized by Sigma-Aldrich (St. Louis, Missouri, US) and all constructs were verified by sequencing at Microsynth Seqlab GmbH (Göttingen ...
-
bioRxiv - Bioengineering 2021Quote: ... was used with CyHV-3 specific primers and probes (Sigma-Aldrich, St. Louis, USA). Further information is given in the Supporting Material (Table S3) ...