Labshake search
Citations for Millipore Sigma :
751 - 800 of 2519 citations for ssc mir 376c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Primers were synthesized by Integrated DNA Technologies (IDT; Sigma-Aldrich). Sequences of designed primers were as below:
-
bioRxiv - Cell Biology 2020Quote: ... All primer sequences used were purchased predesigned from Sigma Aldrich UK (sequences found in Supplementary Table 1) ...
-
bioRxiv - Immunology 2021Quote: ... 20-mer gRNA sequences were introduced into primers (Millipore Sigma) and after hybridization were cloned into Esp3I-digested lentiGuide-puro using the NEBuilder® HiFi DNA Assembly Master mix (E2621 ...
-
bioRxiv - Bioengineering 2022Quote: ... Cat# N0447] and primers (all Sigma-Aldrich, Supplementary Table 2) and were performed strictly following previously published protocols.35
-
bioRxiv - Microbiology 2022Quote: ... DNA oligo primers were obtained from Sigma-Aldrich (Table S4). PCR products were purified using the PureLink PCR purification kit (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... The recommended primers and PCR protocols designed by Jackson laboratories were used to verify the transgenes (primers purchased from Sigma). Following PCR amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... and standard desalted p5 and p7 primers (Sigma, Table S1), containing inline-barcodes for multiplexing and partial adapters for Illumina sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... and primer removal using the SeqPlex RNA Amplification Kit (Sigma) yielding 150 to 400 nucleotide cDNA fragments ...
-
bioRxiv - Microbiology 2023Quote: Primers used in this study were purchased from Sigma-Aldrich and are listed in Table S1 ...
-
bioRxiv - Biochemistry 2023Quote: ... The primers were designed using SnapGene and synthesized by Sigma. The mutations were verified by Sanger sequencing.
-
bioRxiv - Bioengineering 2023Quote: ... Gene-specific pre-designed oligonucleotide primers were purchase from Sigma. qRT-PCR was done using SsoAdvanced Universal SYBR Green Supermix and SFX96 Touch real time PCR detection system (Bio-Rad ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primers used for each target gene were purchased from Sigma and are listed in Table S3
-
bioRxiv - Microbiology 2023Quote: ... Primers were acquired from Sigma Aldrich (St. Louis, MO, USA).
-
bioRxiv - Molecular Biology 2024Quote: ... 10 pmol probe (IDT) and 10 pmol NDP1 primer (Sigma) (see sequences in Table S4 ...
-
bioRxiv - Microbiology 2021Quote: ... using the primers indicated in Table 1 after cDNA synthesis using random hexamer primers and Roche AMV reverse transcriptase (10109118001 Roche, Sigma-Aldrich, St. Louis, MO, USA). Samples were multiplexed using Takara long amplicon Taq polymerase with GC buffers following the manufacturer’s instructions for PCR barcoding for nanopore sequencing (EXP-PBC096 Oxford Nanopore Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... and stained for 5 minutes at RT with Giemsa (Sigma) diluted 1:1 in deionized water ...
-
bioRxiv - Microbiology 2021Quote: ... and stained for 5 minutes at RT with Giemsa (Sigma) diluted 1:1 in deionized water ...
-
bioRxiv - Pathology 2022Quote: ... permeabilized (0.1% Triton X-100, Sigma, in PBS, 20min., RT), blocked with 2% goat serum (Life technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was extracted using RNAzol®RT (Sigma-Aldrich) and 2 µg of total RNA was subjected to reverse transcription using qScript cDNA Synthesis Kit (Quanta) ...
-
bioRxiv - Cell Biology 2020Quote: ... the TRAPEZE® RT Telomerase Detection Kit (Chemicon; EMD Millipore) was utilized ...
-
bioRxiv - Developmental Biology 2021Quote: ... or Kicqstart One-Step Probe RT-qPCR ReadyMix (KCQS07; Sigma). Gli1 (Wen et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... RT and alkylated using 5.5 mM of iodoacetamide (Sigma-Aldrich) for 45 min ...
-
bioRxiv - Immunology 2022Quote: ... fixed cells were blocked at RT with 1% BSA (Sigma) in PBS for 30 min and permeabilized with 0.1% Triton-X100 (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... were incubated for 1h at RT and DAPI (Sigma-Aldrich) was added for 10min to counterstain nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... for 20 min at RT and 70% isopropanol (Sigma-Aldrich) was added for 5 min ...
-
bioRxiv - Genetics 2023Quote: ... and 1 volume of chloroform (2 min, RT, Sigma Aldrich), the aqueous phase was recovered after centrifugation at 12 000 g ...
-
bioRxiv - Microbiology 2023Quote: ... viral RNA was isolated using RNAzol®RT (Sigma- Aldrich) as per manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... After on-column DNase treatment with the DNase I Digest Set (Sigma-Aldrich, Taufkirchen, Germany) the RNA was quantified ...
-
bioRxiv - Plant Biology 2020Quote: ... After on-column DNase treatment with the DNase I Digest Set (Sigma-Aldrich, Taufkirchen, Germany), the RNA was quantified ...
-
bioRxiv - Cell Biology 2021Quote: ... the exposed surface was immediately re-embedded in Durcupan ACM resin (Sigma Aldrich, set 44610). The detail procedures of coverslip preparation ...
-
TRPA1 block protects against loss of white matter function during ischaemia in the mouse optic nervebioRxiv - Neuroscience 2021Quote: ... and 0.05 Alexa Fluor 594 pH set to 7.15 with K-OH (all from Sigma). For Ca2+ imaging experiments ...
-
bioRxiv - Microbiology 2019Quote: ... These experiments were set up in duplicate so that biofilm determination with crystal violet (Sigma) and viable cell counts could be performed in parallel ...
-
bioRxiv - Neuroscience 2019Quote: ... Cortices were homogenized using a Dounce tissue grinder set (Loose followed by Tight pestle, Sigma) in ice cold 300 μl RIPA buffer supplemented with Complete EDTA-free Protease inhibitor (Roche) ...
-
bioRxiv - Neuroscience 2019Quote: ... 1% NP-40 supplemented with protease inhibitor cocktail set V EDTA free (Millipore, Billerica, MA) and phosphatase inhibitors (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... and one set was treated with 1.5 uM 6-TG (Sigma Aldrich, Cat. No. A4882) for 4 days to screen for cells with MLH1 successfully knocked out ...
-
bioRxiv - Microbiology 2023Quote: ... and one set of two replicates were treated with 0.2 μg/ml tetracycline (T3383, Sigma) for 90 min ...
-
bioRxiv - Genetics 2024Quote: ... quantification in the heads of both starved and non-starved miR-210 KO and WT flies was carried out using the Triglyceride Quantification Kit (Sigma-Aldrich, St. Louis, Missouri, USA), following the provided manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... and primers (See Supplementary Table 3) were synthesized by Sigma-Aldrich. The expression of each gene was normalized to the geometric mean expression of two reference genes Hprt and Ubc ...
-
bioRxiv - Cell Biology 2022Quote: ... The primers used in this study were manufactured by Sigma-Aldrich and sequencing reactions were carried out by AgriGenome Labs Pvt ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR was performed using PAGE purified primer pairs (Sigma; Table S1) that spanned appropriate promoter regions of interest ...
-
bioRxiv - Microbiology 2019Quote: ... 20 ng of cDNA and 0.2 µM of each primer (Sigma). For amplification of cDNA of fHbp ...
-
bioRxiv - Physiology 2021Quote: ... according to the manufacturer’s protocol and using specific primers (Sigma-Aldrich) for genes of interest (Table S1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cloning and sequencing primers were supplied by Sigma (Burlington, MA). All plasmids were grown up in Top10 competent bacteria (Invitrogen ...
-
bioRxiv - Systems Biology 2021Quote: Primers were purchased as 20μM stocks (Sigma-Aldrich, standard de-salt). AxFUCCI plasmid sequence was verified by Sanger sequencing.
-
bioRxiv - Microbiology 2021Quote: ... using PAGE-purified oligonucleotide primers (Sigma-Aldrich, St. Louis, MO, USA) according to manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primers used for H3K27me3 ChIP-qPCR were synthetized by SIGMA-ALDRICH. Primer sequences were:
-
bioRxiv - Microbiology 2022Quote: ... The forward primer contained a 6-FAM (6-carboxyfluorescein) tag (Sigma). EMSA reaction mixtures (25 μL volume ...
-
bioRxiv - Biochemistry 2022Quote: ... two corresponding primers (synthesized by IDT) and KOD polymerase (Sigma-Aldrich). Specifically ...
-
bioRxiv - Physiology 2022Quote: ... The primers were customized and purchased from Sigma-Aldrich (now Merck): human Rpl0 fw (TCGACAATGGCAGCATCTAC) ...
-
bioRxiv - Neuroscience 2022Quote: ... The sequence for telomere-specific forward and reverse primers (Sigma-Aldrich) are 5’ CGG TTT GTT TGG GTT TGG GTT TGG GTT TGG GTT TGG GTT 3’ & 5’ GGC TTG CCT TAC CCT TAC CCT TAC CCT TAC CCT TAC CCT 3’ ...