Labshake search
Citations for Millipore Sigma :
7401 - 7450 of 10000+ citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 2 mL of thawed filtered lentivirus was used to transduce approximately 2.25×106 HFF-T or 3×106 RPE cells in 10 cm plates with 8 µg/mL polybrene (Millipore-Sigma: TR-1003-G). Cells were allowed to reach confluence before selection with 1 µg/mL puromycin for 3 days ...
-
bioRxiv - Cell Biology 2022Quote: ... Strains containing AID tag alleles were treated with final concentrations of 250 µM 3-indole acetic acid (Sigma-Aldrich, St. Louis, MO, USA) in DMSO and buffered with 50 mM potassium phosphate buffer at pH 6.2 for the 30 minutes prior to harvesting or imaging ...
-
bioRxiv - Developmental Biology 2022Quote: ... Slides were subsequently washed 3 times with PBS for 10 minutes and mounted in Duolink in situ mounting medium with DAPI (Sigma-Aldrich, #DUO82020-5ML).
-
bioRxiv - Cell Biology 2022Quote: ... 3 μM-sections were deparaffinized and antigen retrieval was performed in 10 mM citrate buffer (pH = 6; Sigma-Aldrich, St Louis, MO, USA) for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... a known volume of trolox standard concentration would result in a similar reduction of the radical 2,2’-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid (Sigma-Aldrich, St. Louis, MO). Samples were analyzed in triplicate ...
-
bioRxiv - Microbiology 2022Quote: ... Both strains were initially grown anaerobically at 37°C for 3–5 days on Bifido Selective Media (BSM) agar plates (Millipore Sigma, Burlington, MA), from which a single colony was selected and grown in BSM broth (Millipore Sigma ...
-
bioRxiv - Zoology 2022Quote: The frogs underwent double euthanasia according to institutional ethics guidelines under ethics approval number NWU-00380-16-A5-01: first anaesthesia in 6% ethyl-3-aminobenzoate methansulfonate (MS222) (Sigma-Aldrich Co., USA) and then euthanasia through pithing.
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... The beads were then removed by magnetic separation and cells were spinoculated with HIV-GFP-Thy1.2 (pNL4-3-−Δ6-dreGFP-CD90) and 8 ug/mL polybrene (Millipore Sigma; TR-1003-G) for 2 hrs at 1100 x g ...
-
bioRxiv - Microbiology 2023Quote: C57BL/6J wild type and LDLR KO (B6.129S7-Ldlrtm1her/J) mice were intraperitoneally injected by 3% brewer thioglycollate medium (Millipore-Sigma, St. Louis, MO, USA). Mouse peritoneal cavity elicited macrophages (MØ ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... was purchased from Pfaltz and Bauer (Item #: M19160) and ?99% 4-methyl-3-heptanol (mixture of stereoisomers) was purchased from Sigma-Aldrich (Item #: M48309). Compounds were freshly diluted on each day of behavioral experiments ...
-
bioRxiv - Physiology 2023Quote: ... cardiac mitochondria isolated from 3-5 pooled hearts of each genotype were lysed on ice for 30 min in 1X RIPA buffer (EMD Millipore #20-188) supplemented with 1X protease inhibitors (Sigma-Aldrich #S8830-20TAB) ...
-
bioRxiv - Plant Biology 2023Quote: ... 1.5-ml glass vials (Ø×H 11.6 × 32 mm) containing ∼ 100 mg glass wool were filled with 200 µl (Z)-3-hexenyl acetate (HAC, >98%, Sigma-Aldrich, Buchs, Switzerland) and sealed with screw caps containing a rubber septum ...
-
bioRxiv - Cell Biology 2024Quote: ... S% C02 in DMEM supplemented with 40 μM BrdU/BrdC (ratio 3:l, BrdU: BS002, Sigma-Aldrich, BrdC: sc-284SSS, Santa Cruz Biotech). Degradation of EGFP-AID-STAG2 was induced by the addition of S00 µM Inole-3-acetic acid (IAA ...
-
bioRxiv - Developmental Biology 2024Quote: 20-hydroxyecdysone (20-E, CAS-number: 5289-74-7) and cucurbitacin B (CucB, CAS-number: 6199-67-3) were obtained from Sigma-Aldrich (MA, USA). Based on our preliminary tests to check for lethal or critical effects on development ...
-
bioRxiv - Microbiology 2024Quote: ... a collagen raft mixture was prepared on ice via combining 3 mg/ml collagen with 10X E-Media (Powdered DMEM (Millipore Sigma, D7777-10L), powdered Ham’s F-12 (Millipore Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... Chilled lysis buffer (10 mM Tris-HCl, 10 mM NaCl, 3 mM MgCl2, and 0.1% Nonidet™ P40 Substitute (Sigma Aldrich, PN-74385) was added to the tissue and the tube was incubated on ice for 15 min with gentle shaking during the incubation ...
-
bioRxiv - Molecular Biology 2024Quote: ... 400 μL of conditioned media from human ovarian cortex and medulla explant tissue cultures in both doxorubicin treatment and control conditions was concentrated to ∼30 µL with 0.5 mL 3 kDa filters (Millipore Sigma, Burlington, MA, USA). Aliquots of concentrated secretome (15 µL ...
-
bioRxiv - Microbiology 2024Quote: ... 20 µL of the cell suspension was added to microscope slides pre-treated with microscope slides pre-treated with 0.1% poly-L-lysine and washed three times with 3% BSA (Sigma Aldrich 9048-46-8) diluted in PBS ...
-
bioRxiv - Immunology 2024Quote: Thirty µg of retentate from whole cell lysate from Msm and Mtb after ultrafiltration with 3 kDa filters (Millipore Sigma, Product Number: UFC9003), was subjected to in-gel trypsin digestion as described previously [31] ...
-
bioRxiv - Biophysics 2024Quote: ... The eluate protein from NiNTA columns was buffer exchanged into PBS pH 7.4 and concentrated with a 3 kDa Amicon® Ultra-4 Centrifugal Filter Units (Millipore Sigma Cat# UFC800308). Proteins were frozen and stored at -80 °C.
-
bioRxiv - Bioengineering 2024Quote: ... Metabolic and mitochondrial activity of host cells was assessed with a resazurin assay (7-Hydroxy-3H-phenoxazin-3-one-10-oxide sodium salt, Sigma-Aldrich, Overijse, Belgium). Medium was refreshed with 1 mL of 0.01 mg/mL resazurin in DMEM and incubated for 2 h at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The flow-through and washes were then pooled and concentrated using a concentrator with a 3 kDa molecular weight cut-off (Millipore, Burlington, MA, USA) and the protein was filtered through polyvinylidene fluoride ultra-free membrane filter with a 0.22 μm pore size (Millipore) ...
-
bioRxiv - Microbiology 2024Quote: ... Membrane protein topology was assayed by plating the resulting reporter strains on dual-indicator plates containing LB agar supplemented with 80 μg/ml 5-bromo-4-chloro-3-indolyl phosphate disodium salt (X-Phos) ([Sigma Aldrich], RES1364C-A101X) and 100 μg/mL 6-chloro-3-indolyl-β-d-galactoside (Red-Gal ...
-
bioRxiv - Neuroscience 2024Quote: ... Stained networks were dehydrated with 3 washes with reagent alcohol and then mounted using organic mounting medium (Organo/Limonene Mount, Sigma-Aldrich, Cat#O8015). Dried slides were imaged using a Hamamatsu S210 NanoZoomer Digital Slide Scanner at 40X magnification by the Microscopy Core at The Jackson Laboratory ...
-
bioRxiv - Biochemistry 2024Quote: ... Bands were visualized using the nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (BCIP/ NBT, Sigma-Aldrich, St. Louis, MO, USA) reaction ...
-
bioRxiv - Plant Biology 2024Quote: ... The FPLC fraction containing NCR13 was concentrated and desalted using an Amicon Stirred Cell with a 3-kD cutoff membrane (Millipore, Cat No: PLBC04310) and further purified by reverse phase C18-HPLC ...
-
bioRxiv - Synthetic Biology 2024Quote: ... for each TAR fragment were used to first amplify the YCpBAC plasmid to generate linear capture plasmids with 45 bp of sequence homology associated with the 5’ and 3’ ends of each viral genomic fragment using KOD Xtreme Hot Start DNA Polymerase (KODpol; Sigma-Aldrich, 71975-M) following the manufacturer’s instructions for two-step cycling ...
-
bioRxiv - Cancer Biology 2024Quote: ... oral gavage for 21 days, using a 4-day-on, 3-day-off schedule) (Selleckchem, S7694), tamoxifen (20mg/kg, subQ, 5 doses/week) (Sigma Aldrich, T5648-1G), abemaciclib (75mg/kg ...
-
bioRxiv - Developmental Biology 2024Quote: ... washed with PBS and cleared for at least 3 days in the cold room with 1.62 M Histodenz medium and 0.1% Tween 20 (both from Sigma-Aldrich, St. Louis, MO, USA) (93) ...
-
bioRxiv - Biophysics 2024Quote: ... The dissociated pellets were buffer exchanged to 10 mM PBS (pH 7.4) using a 3 kDa centrifuge filter (Millipore Sigma, St. Louis, MO). The samples were loaded onto a 4-20% Mini-PROTEAN precast protein gel (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... from IMR-90 cultures under different tensions and doxo treatments were concentrated using 3 kDa molecular cut-off filters (Millipore Sigma, Burlington, MA) and protein content was quantified using the bicinchoninic acid assay (BCA ...
-
bioRxiv - Bioengineering 2024Quote: Hydrogels were formed on 12 mm or 25 mm circular glass coverslips treated with (3-Mercaptopropyl)trimethoxysilane (MPTS, Sigma Aldrich, Cat. No. 175617) via overnight vapor deposition at 60°C ...
-
bioRxiv - Cell Biology 2024Quote: ... and the cells were embedded in a matrix gel composed of monomer solution (MS) [19% (wt/wt) sodium acrylate (Chem Cruz, Sigma 7446-81-3), 10% (wt/wt ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 200 µM Tris [(1-benzyl-1H-1,2,3-triazol-4- yl)methyl]amine (TBTA; Sigma Aldrich, 678937-50MG), 500 µM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP ...
-
bioRxiv - Cell Biology 2020Quote: ... were cultured from separated dental papilla tissues of P1 tooth germs following digestion with 3 mg/ml collagenase I (Sigma, St. Louis, MO, USA) for approximately 45min at 37C ...
-
bioRxiv - Immunology 2021Quote: ... The membrane was blocked using 1x TBST+ 3% Casein followed by overnight incubation at 4°C with biotinylated Lectin from Triticum Vulgaris (Sigma/Merck Cat. No. L5142). The membrane was washed with 1XTBST and further Incubated with Streptavidin PerCP-eFluor710 Conjugated ...
-
bioRxiv - Neuroscience 2021Quote: ... for 15 min each (30%, 50%, 75%, 90%, 3× 100%) and incubated with increasing concentrations of the epoxy resin Durcupan (Sigma-Aldrich, St. Louis, USA) (2:1 ...
-
bioRxiv - Genomics 2020Quote: ... an oligonucleotide was designed based on sequences of the telomeric satellite albi_telomere1: GTTCCTATAGCTTCTCTCACTCAAGTAGCCT and labelled with 3’-end-Cyanine3 fluorochrome (Sigma-Aldrich, St. Louis, MO, USA) The sequence of the oligonucleotide probe is AGGCTACTTGAGTGAGAGAAGCTATAGGAAC [Cyanine3] ...
-
bioRxiv - Neuroscience 2021Quote: ... the four-month-old APP/PS1 mice under vitamin D3-sufficient diet condition were intraperitoneally injected weekly with 3 mg/kg of p53 inhibitor Pifithrin-α (PFTα, Sigma-Aldrich, Cat# P4359) for 3 months before harvesting hippocampal tissues for analysis ...
-
bioRxiv - Physiology 2020Quote: ... Cells were incubated at RT for 3 hrs in 300 μl secondary antibody solution containing anti-rabbit TRITC (Sigma-Aldrich Cat# T6778, RRID: AB_261740) at a concentration of 1:75 in 1× TBS ...
-
bioRxiv - Microbiology 2020Quote: Three GS inhibitors were used to study the effect of GS on parasite infectivity and growth during liver stage development: 3-aminoimidazo[1,2-a]pyridine (Sigma Aldrich; Cat no. 685755; AIP), Glufosinate Ammonium (Sigma Aldrich ...
-
bioRxiv - Microbiology 2021Quote: Nitrite concentration in the lung homogenate was measured (n=3 per group per time point) using Griess Reagent kit following manufacturer instructions (Sigma, St. Louis, MO, USA). Absorbance was recorded using a GloMax plate reader (Promega Corporation ...
-
bioRxiv - Plant Biology 2021Quote: Root tissue was manually ground and 70 mg of pulverized tissue was used for the extraction with 0.7 mL 80% methanol (v/v) containing 6.10−3 mg/ml Ribitol (Sigma Aldrich, St. Louis, Missouri, United States) as internal standard ...
-
bioRxiv - Cancer Biology 2022Quote: A gBlock Gene Fragment coding for DHFR2 – αB7-H3 scFv fusion protein was ordered from Integrated DNA Technologies (IDT) and cloned into the Novagen pET28a(+) vector (EMD Millipore, Cat: 69864–3) via the NcoI and XhoI restriction sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... The eluted protein was dialyzed into water or 25 mM MES pH 5.5 and 25 mM NaCl and concentrated using a Vivaspin 20 centrifugal concentrator with a 3 kDa molecular weight cutoff (Millipore Sigma, St. Louis, MO).
-
bioRxiv - Bioengineering 2022Quote: ... and αCD133-scFv-DHFR2 fusion proteins were ordered from Integrated DNA Technologies (IDT) and cloned into the Novagen pET28a(+) vector (EMD Millipore, Cat: 69864-3) via NcoI and XhoI restriction sites ...
-
bioRxiv - Microbiology 2022Quote: ... gambiae females injected with dsRNA were treated for 3 days with a sugar solution containing 1mg/ml Bromodeoxyuridine (Sigma Aldrich, St. Louis, MO, USA). At day four post dsRNA injection ...
-
bioRxiv - Biochemistry 2022Quote: ... The two aqueous streams were supplied with the cell solution and with a 3 μM substrate solution containing lysis agents (0.7× BugBuster protein extraction reagent, Merck Millipore; 60 kU/mL rLysozyme, Novagen) in droplet assay buffer ...
-
bioRxiv - Immunology 2020Quote: ... Wapl-degron v-Abl pro-B lines were treated with 150 μM Indole-3-acetic acid (auxin analog, IAA, Sigma-Aldrich, #I3750-25G-A) and 2 mg/mL doxycycline (Dox ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500μg of lysates in 500 μL of SEC buffer were incubated for 3 hours with primary antibodies directed to either AGO proteins (WAKO anti-AGO2 #011-22033, EMD Millipore anti-panAGO #MABE56) or directed to T6B-fusion protein (Cell Signaling anti-FLAG #8146S ...